Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632402_at:

>probe:Drosophila_2:1632402_at:142:129; Interrogation_Position=1368; Antisense; ACCAGCTAAGCAACATCTCGGATCT
>probe:Drosophila_2:1632402_at:429:643; Interrogation_Position=1383; Antisense; TCTCGGATCTAAGGGTTCGCAGCAA
>probe:Drosophila_2:1632402_at:347:349; Interrogation_Position=1417; Antisense; GCAGTGCGAAGCTCCTTTCAAGCAG
>probe:Drosophila_2:1632402_at:509:217; Interrogation_Position=1457; Antisense; AAGTACCATGATGATCCGCAGCTCA
>probe:Drosophila_2:1632402_at:85:227; Interrogation_Position=1502; Antisense; AAGGCACTACTTCATCATGGCGCGA
>probe:Drosophila_2:1632402_at:491:387; Interrogation_Position=1556; Antisense; GAAAAGACTCTCCTCGATTACTACT
>probe:Drosophila_2:1632402_at:377:155; Interrogation_Position=1598; Antisense; ACAGAAGATCTCCTGCGGCAAGCAG
>probe:Drosophila_2:1632402_at:236:175; Interrogation_Position=1645; Antisense; AAACTCCGACTACTGTCAGCATGGC
>probe:Drosophila_2:1632402_at:264:519; Interrogation_Position=1676; Antisense; GTGGTGCAGCAATATCGCGATCATT
>probe:Drosophila_2:1632402_at:523:587; Interrogation_Position=1719; Antisense; TGGAGCGCTTATGGCGGCAGCACTT
>probe:Drosophila_2:1632402_at:495:699; Interrogation_Position=1766; Antisense; TTTTTGCCCGAACTCTGGAATGTCA
>probe:Drosophila_2:1632402_at:147:205; Interrogation_Position=1842; Antisense; AAGCCGATCTTATGGTGGCCGGATT
>probe:Drosophila_2:1632402_at:249:79; Interrogation_Position=1895; Antisense; AGGGCTTTTCTGAGTTTGCCACCGG
>probe:Drosophila_2:1632402_at:442:309; Interrogation_Position=1912; Antisense; GCCACCGGCTTTGTACGTTTTATAT

Paste this into a BLAST search page for me
ACCAGCTAAGCAACATCTCGGATCTTCTCGGATCTAAGGGTTCGCAGCAAGCAGTGCGAAGCTCCTTTCAAGCAGAAGTACCATGATGATCCGCAGCTCAAAGGCACTACTTCATCATGGCGCGAGAAAAGACTCTCCTCGATTACTACTACAGAAGATCTCCTGCGGCAAGCAGAAACTCCGACTACTGTCAGCATGGCGTGGTGCAGCAATATCGCGATCATTTGGAGCGCTTATGGCGGCAGCACTTTTTTTGCCCGAACTCTGGAATGTCAAAGCCGATCTTATGGTGGCCGGATTAGGGCTTTTCTGAGTTTGCCACCGGGCCACCGGCTTTGTACGTTTTATAT

Full Affymetrix probeset data:

Annotations for 1632402_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime