FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632404_at:

>probe:Drosophila_2:1632404_at:490:473; Interrogation_Position=1131; Antisense; GTTCACCGTCACATTTCTGATGTAC
>probe:Drosophila_2:1632404_at:620:11; Interrogation_Position=1161; Antisense; ATTCGGTTACACTTCGATGGATCAG
>probe:Drosophila_2:1632404_at:125:533; Interrogation_Position=1206; Antisense; GGGTGTAATCATGACTTTGCTGCAG
>probe:Drosophila_2:1632404_at:593:405; Interrogation_Position=1244; Antisense; GACGGCTGCCCGAGGCGAAGATCAA
>probe:Drosophila_2:1632404_at:202:341; Interrogation_Position=1271; Antisense; GCTATGCCATCTTCAGTTTGTACCT
>probe:Drosophila_2:1632404_at:111:91; Interrogation_Position=1285; Antisense; AGTTTGTACCTGATTGTACCCGCCT
>probe:Drosophila_2:1632404_at:723:1; Interrogation_Position=1297; Antisense; ATTGTACCCGCCTTCGTAGTAGTCG
>probe:Drosophila_2:1632404_at:195:649; Interrogation_Position=1444; Antisense; TCAGTACTGGGCATATTCCGCTCAC
>probe:Drosophila_2:1632404_at:480:445; Interrogation_Position=1505; Antisense; GATGCATTGCCTTCTGGTGCGTTGG
>probe:Drosophila_2:1632404_at:549:507; Interrogation_Position=1521; Antisense; GTGCGTTGGCTCCAGGATCACCTAT
>probe:Drosophila_2:1632404_at:116:79; Interrogation_Position=1534; Antisense; AGGATCACCTATATAGCCGGCGGAC
>probe:Drosophila_2:1632404_at:264:573; Interrogation_Position=1552; Antisense; GGCGGACTTCTGCTCATTTATCCAG
>probe:Drosophila_2:1632404_at:628:17; Interrogation_Position=1567; Antisense; ATTTATCCAGCCATGGCCTTGCAAC
>probe:Drosophila_2:1632404_at:713:253; Interrogation_Position=1588; Antisense; CAACGCGCTCGCATTTAAGTGCAAT

Paste this into a BLAST search page for me
GTTCACCGTCACATTTCTGATGTACATTCGGTTACACTTCGATGGATCAGGGGTGTAATCATGACTTTGCTGCAGGACGGCTGCCCGAGGCGAAGATCAAGCTATGCCATCTTCAGTTTGTACCTAGTTTGTACCTGATTGTACCCGCCTATTGTACCCGCCTTCGTAGTAGTCGTCAGTACTGGGCATATTCCGCTCACGATGCATTGCCTTCTGGTGCGTTGGGTGCGTTGGCTCCAGGATCACCTATAGGATCACCTATATAGCCGGCGGACGGCGGACTTCTGCTCATTTATCCAGATTTATCCAGCCATGGCCTTGCAACCAACGCGCTCGCATTTAAGTGCAAT

Full Affymetrix probeset data:

Annotations for 1632404_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720