FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632406_at:

>probe:Drosophila_2:1632406_at:133:397; Interrogation_Position=344; Antisense; GACACTCTGACCACATCGGTTGCAA
>probe:Drosophila_2:1632406_at:43:41; Interrogation_Position=358; Antisense; ATCGGTTGCAACTATCTGTTTCAGA
>probe:Drosophila_2:1632406_at:447:355; Interrogation_Position=385; Antisense; GCACGAATGCATTTGGTCGGCGCAT
>probe:Drosophila_2:1632406_at:432:411; Interrogation_Position=424; Antisense; GACCTCTACATGGACCACCTTGGTA
>probe:Drosophila_2:1632406_at:274:195; Interrogation_Position=467; Antisense; AACTGGCCCTAGATTCGAATGCCGA
>probe:Drosophila_2:1632406_at:347:263; Interrogation_Position=525; Antisense; CAGCTGCGTTTCAGTTCTTGTGGAA
>probe:Drosophila_2:1632406_at:422:483; Interrogation_Position=575; Antisense; GTATCACCGGAGATCTCTTCGAGCG
>probe:Drosophila_2:1632406_at:652:189; Interrogation_Position=622; Antisense; AACATTTGGATGGACGCTGGAAGCG
>probe:Drosophila_2:1632406_at:616:507; Interrogation_Position=693; Antisense; GTGCGAGTTTATAATCCCAGGACAT
>probe:Drosophila_2:1632406_at:267:153; Interrogation_Position=714; Antisense; ACATGGTCCGATGTTTTCTGTCACA
>probe:Drosophila_2:1632406_at:47:717; Interrogation_Position=729; Antisense; TTCTGTCACACAATCAATGCGCTGT
>probe:Drosophila_2:1632406_at:438:411; Interrogation_Position=766; Antisense; GACGCCACTTCTAACACTTAATTTA
>probe:Drosophila_2:1632406_at:18:471; Interrogation_Position=837; Antisense; GTTCTAGCTTTCCTTGATTACCAGT
>probe:Drosophila_2:1632406_at:8:165; Interrogation_Position=900; Antisense; AAATCAAATTTTCCGCCACTACATA

Paste this into a BLAST search page for me
GACACTCTGACCACATCGGTTGCAAATCGGTTGCAACTATCTGTTTCAGAGCACGAATGCATTTGGTCGGCGCATGACCTCTACATGGACCACCTTGGTAAACTGGCCCTAGATTCGAATGCCGACAGCTGCGTTTCAGTTCTTGTGGAAGTATCACCGGAGATCTCTTCGAGCGAACATTTGGATGGACGCTGGAAGCGGTGCGAGTTTATAATCCCAGGACATACATGGTCCGATGTTTTCTGTCACATTCTGTCACACAATCAATGCGCTGTGACGCCACTTCTAACACTTAATTTAGTTCTAGCTTTCCTTGATTACCAGTAAATCAAATTTTCCGCCACTACATA

Full Affymetrix probeset data:

Annotations for 1632406_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720