FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632407_at:

>probe:Drosophila_2:1632407_at:436:479; Interrogation_Position=1087; Antisense; GTTTCGGCGATCAACGACCAGGCCA
>probe:Drosophila_2:1632407_at:581:315; Interrogation_Position=1133; Antisense; GCCTTGTCCCGCTCAAAGGATATCA
>probe:Drosophila_2:1632407_at:663:457; Interrogation_Position=1151; Antisense; GATATCATCCGGAGGTCTTCCGCTT
>probe:Drosophila_2:1632407_at:16:249; Interrogation_Position=1184; Antisense; AATTGGCCAGCGATCAGGTGGCGCT
>probe:Drosophila_2:1632407_at:300:337; Interrogation_Position=1215; Antisense; GCTCAAGTTCTTCAATGTCACCAGA
>probe:Drosophila_2:1632407_at:146:385; Interrogation_Position=1279; Antisense; GAACTAGTGCTCATTCAGTTTCACG
>probe:Drosophila_2:1632407_at:74:31; Interrogation_Position=1307; Antisense; ATAAAAAGACCTGGGACTGCTCACC
>probe:Drosophila_2:1632407_at:263:145; Interrogation_Position=1322; Antisense; ACTGCTCACCCTTCAATCTTGATTA
>probe:Drosophila_2:1632407_at:18:403; Interrogation_Position=763; Antisense; GACATATTCCTAATGATGCTGGGCA
>probe:Drosophila_2:1632407_at:184:499; Interrogation_Position=791; Antisense; GTCTCAGCGAGATGTTGGCCAGGCT
>probe:Drosophila_2:1632407_at:523:349; Interrogation_Position=834; Antisense; GCAGGTGCGACAGCCCATGCCGGAA
>probe:Drosophila_2:1632407_at:706:203; Interrogation_Position=857; Antisense; AAGCCTATTGGACGTGGTCACGCAC
>probe:Drosophila_2:1632407_at:538:135; Interrogation_Position=876; Antisense; ACGCACTCTTTATCGCTCCATAGTA
>probe:Drosophila_2:1632407_at:160:301; Interrogation_Position=924; Antisense; CGCCGTGTCCGGTATAATGCTGATA

Paste this into a BLAST search page for me
GTTTCGGCGATCAACGACCAGGCCAGCCTTGTCCCGCTCAAAGGATATCAGATATCATCCGGAGGTCTTCCGCTTAATTGGCCAGCGATCAGGTGGCGCTGCTCAAGTTCTTCAATGTCACCAGAGAACTAGTGCTCATTCAGTTTCACGATAAAAAGACCTGGGACTGCTCACCACTGCTCACCCTTCAATCTTGATTAGACATATTCCTAATGATGCTGGGCAGTCTCAGCGAGATGTTGGCCAGGCTGCAGGTGCGACAGCCCATGCCGGAAAAGCCTATTGGACGTGGTCACGCACACGCACTCTTTATCGCTCCATAGTACGCCGTGTCCGGTATAATGCTGATA

Full Affymetrix probeset data:

Annotations for 1632407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720