FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632410_at:

>probe:Drosophila_2:1632410_at:392:125; Interrogation_Position=1051; Antisense; AGCCTCGAGATGTCCGTCGTGGATC
>probe:Drosophila_2:1632410_at:310:583; Interrogation_Position=1082; Antisense; TGGCGGCGGACTTCATCCAGAAACA
>probe:Drosophila_2:1632410_at:412:223; Interrogation_Position=1115; Antisense; AAGGACCACTTGCACCGGAGGAATT
>probe:Drosophila_2:1632410_at:660:525; Interrogation_Position=1187; Antisense; GGGAAGCGCACTTGGTCAACACGGC
>probe:Drosophila_2:1632410_at:441:119; Interrogation_Position=1223; Antisense; AGCTGTGCGGCTACCTACAGGAGGA
>probe:Drosophila_2:1632410_at:514:543; Interrogation_Position=705; Antisense; GGATTTGTCCAGAGAAGCCATTCTT
>probe:Drosophila_2:1632410_at:407:11; Interrogation_Position=724; Antisense; ATTCTTACGGAGCACTTTCTACCTA
>probe:Drosophila_2:1632410_at:413:231; Interrogation_Position=778; Antisense; AATGAGTCCATTAGCTACTCCCATC
>probe:Drosophila_2:1632410_at:672:447; Interrogation_Position=831; Antisense; GATGCCCGCTGAATATGGCACCTAT
>probe:Drosophila_2:1632410_at:406:627; Interrogation_Position=863; Antisense; TGCCTCCTCAGCGATACGTGCGTAA
>probe:Drosophila_2:1632410_at:674:563; Interrogation_Position=894; Antisense; GGAAGGTGCCATCGTAATGCTCTAC
>probe:Drosophila_2:1632410_at:31:701; Interrogation_Position=930; Antisense; TTTTCCCGGCCAAGTGAAGCAGCTG
>probe:Drosophila_2:1632410_at:433:377; Interrogation_Position=945; Antisense; GAAGCAGCTGCAAGACATCGTGGGT
>probe:Drosophila_2:1632410_at:453:599; Interrogation_Position=973; Antisense; TGTCTGTATCGCCATCTGGTGTCAC

Paste this into a BLAST search page for me
AGCCTCGAGATGTCCGTCGTGGATCTGGCGGCGGACTTCATCCAGAAACAAAGGACCACTTGCACCGGAGGAATTGGGAAGCGCACTTGGTCAACACGGCAGCTGTGCGGCTACCTACAGGAGGAGGATTTGTCCAGAGAAGCCATTCTTATTCTTACGGAGCACTTTCTACCTAAATGAGTCCATTAGCTACTCCCATCGATGCCCGCTGAATATGGCACCTATTGCCTCCTCAGCGATACGTGCGTAAGGAAGGTGCCATCGTAATGCTCTACTTTTCCCGGCCAAGTGAAGCAGCTGGAAGCAGCTGCAAGACATCGTGGGTTGTCTGTATCGCCATCTGGTGTCAC

Full Affymetrix probeset data:

Annotations for 1632410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720