FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632413_at:

>probe:Drosophila_2:1632413_at:51:243; Interrogation_Position=356; Antisense; AATAGTCGGCACCAATGTCAGCACC
>probe:Drosophila_2:1632413_at:676:471; Interrogation_Position=383; Antisense; GTTCATAACATGTCCGGCAGATCCG
>probe:Drosophila_2:1632413_at:591:207; Interrogation_Position=426; Antisense; AAGCTGCCCTTCCTGGTGATGATCA
>probe:Drosophila_2:1632413_at:111:213; Interrogation_Position=465; Antisense; AAGTACTTCACCTTCGAGGTTCAGG
>probe:Drosophila_2:1632413_at:210:435; Interrogation_Position=480; Antisense; GAGGTTCAGGTTCTCGATGACAAGA
>probe:Drosophila_2:1632413_at:319:679; Interrogation_Position=521; Antisense; TAGGGCCAGTAACTACCAGTCGACA
>probe:Drosophila_2:1632413_at:92:601; Interrogation_Position=551; Antisense; TGTCAAGCCTTTCATTTGCACCATG
>probe:Drosophila_2:1632413_at:375:259; Interrogation_Position=569; Antisense; CACCATGCCCATGCGATTGGACGAG
>probe:Drosophila_2:1632413_at:562:633; Interrogation_Position=635; Antisense; TCGCGCATACGGCACCAATTATGTG
>probe:Drosophila_2:1632413_at:354:399; Interrogation_Position=662; Antisense; GACACTCCGTGTACAGATTCATGCA
>probe:Drosophila_2:1632413_at:663:161; Interrogation_Position=686; Antisense; AAATTGCCGCATCAGACGCGTCTAC
>probe:Drosophila_2:1632413_at:671:547; Interrogation_Position=749; Antisense; GGAGTTTAAGCTCTTCCTTCCCATT
>probe:Drosophila_2:1632413_at:369:719; Interrogation_Position=766; Antisense; TTCCCATTCAGAAGCCGGTGCAGAA
>probe:Drosophila_2:1632413_at:118:707; Interrogation_Position=836; Antisense; TTAGAGCACCTAACCAGACGGAGTC

Paste this into a BLAST search page for me
AATAGTCGGCACCAATGTCAGCACCGTTCATAACATGTCCGGCAGATCCGAAGCTGCCCTTCCTGGTGATGATCAAAGTACTTCACCTTCGAGGTTCAGGGAGGTTCAGGTTCTCGATGACAAGATAGGGCCAGTAACTACCAGTCGACATGTCAAGCCTTTCATTTGCACCATGCACCATGCCCATGCGATTGGACGAGTCGCGCATACGGCACCAATTATGTGGACACTCCGTGTACAGATTCATGCAAAATTGCCGCATCAGACGCGTCTACGGAGTTTAAGCTCTTCCTTCCCATTTTCCCATTCAGAAGCCGGTGCAGAATTAGAGCACCTAACCAGACGGAGTC

Full Affymetrix probeset data:

Annotations for 1632413_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720