Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632414_at:

>probe:Drosophila_2:1632414_at:325:603; Interrogation_Position=1296; Antisense; TGTTAAGTTCTCCATGCCACGTAAT
>probe:Drosophila_2:1632414_at:204:243; Interrogation_Position=1324; Antisense; AATATGCCCGTGTGTGGTGACGCCA
>probe:Drosophila_2:1632414_at:434:619; Interrogation_Position=1385; Antisense; TGCTCAGGGAATTCACACAGGGCTT
>probe:Drosophila_2:1632414_at:501:177; Interrogation_Position=1439; Antisense; AAACTGAGTGTAACTGCCTTCCATC
>probe:Drosophila_2:1632414_at:321:509; Interrogation_Position=1464; Antisense; GTGTACTTCGATTGCCTACGAGGCT
>probe:Drosophila_2:1632414_at:590:449; Interrogation_Position=1491; Antisense; GATCTCCCAGGCTGATTTTGACTAT
>probe:Drosophila_2:1632414_at:330:369; Interrogation_Position=1574; Antisense; GAATGAAGATGTCGCGCGTGTCCAT
>probe:Drosophila_2:1632414_at:211:321; Interrogation_Position=1587; Antisense; GCGCGTGTCCATCTTTTTCAAGGAG
>probe:Drosophila_2:1632414_at:426:575; Interrogation_Position=1631; Antisense; GGCGCTCAGAGCTTTATGGTACCAC
>probe:Drosophila_2:1632414_at:178:133; Interrogation_Position=1654; Antisense; ACCGACTTTCTTGCCAATTGTGGTG
>probe:Drosophila_2:1632414_at:125:249; Interrogation_Position=1669; Antisense; AATTGTGGTGGCTTACTTGGCCTCT
>probe:Drosophila_2:1632414_at:102:65; Interrogation_Position=1696; Antisense; ATGGGCGTCTCCATGCTGAGCATAG
>probe:Drosophila_2:1632414_at:493:561; Interrogation_Position=1722; Antisense; GGAACTGATCTATTTCTGCACCGTG
>probe:Drosophila_2:1632414_at:621:635; Interrogation_Position=1756; Antisense; TCGAACCTAAGGATGCGCCGCAAAA

Paste this into a BLAST search page for me
TGTTAAGTTCTCCATGCCACGTAATAATATGCCCGTGTGTGGTGACGCCATGCTCAGGGAATTCACACAGGGCTTAAACTGAGTGTAACTGCCTTCCATCGTGTACTTCGATTGCCTACGAGGCTGATCTCCCAGGCTGATTTTGACTATGAATGAAGATGTCGCGCGTGTCCATGCGCGTGTCCATCTTTTTCAAGGAGGGCGCTCAGAGCTTTATGGTACCACACCGACTTTCTTGCCAATTGTGGTGAATTGTGGTGGCTTACTTGGCCTCTATGGGCGTCTCCATGCTGAGCATAGGGAACTGATCTATTTCTGCACCGTGTCGAACCTAAGGATGCGCCGCAAAA

Full Affymetrix probeset data:

Annotations for 1632414_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime