Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632417_a_at:

>probe:Drosophila_2:1632417_a_at:666:509; Interrogation_Position=1005; Antisense; GTGACATGCAACCAGTATGCCACAT
>probe:Drosophila_2:1632417_a_at:11:683; Interrogation_Position=1020; Antisense; TATGCCACATGGTTTTATTTCGAAT
>probe:Drosophila_2:1632417_a_at:230:701; Interrogation_Position=1109; Antisense; TTTTATTCTCTGCATCTTAATCTGA
>probe:Drosophila_2:1632417_a_at:261:473; Interrogation_Position=714; Antisense; GTTCTTCAAGAATGCCGTGGACATC
>probe:Drosophila_2:1632417_a_at:692:309; Interrogation_Position=765; Antisense; GCCAACAAATGTACGCCCGACGGGA
>probe:Drosophila_2:1632417_a_at:711:723; Interrogation_Position=795; Antisense; TTGAGCTGGTGGAGACGCCATCTAC
>probe:Drosophila_2:1632417_a_at:564:103; Interrogation_Position=807; Antisense; AGACGCCATCTACTAAGTCACCTTG
>probe:Drosophila_2:1632417_a_at:378:335; Interrogation_Position=841; Antisense; GCTGCAGCGCATTCCAAAGAGTATT
>probe:Drosophila_2:1632417_a_at:53:213; Interrogation_Position=857; Antisense; AAGAGTATTCGACGCTTCTTCTGGC
>probe:Drosophila_2:1632417_a_at:418:555; Interrogation_Position=884; Antisense; GGACCACGACCTTCGATTGGCATCG
>probe:Drosophila_2:1632417_a_at:569:43; Interrogation_Position=905; Antisense; ATCGCTGTCTGTGTACCATATGTAA
>probe:Drosophila_2:1632417_a_at:653:697; Interrogation_Position=937; Antisense; TTTAGCCATACTGCAATCTACCATA
>probe:Drosophila_2:1632417_a_at:188:653; Interrogation_Position=960; Antisense; TAATCATTTCTTACTTTTACTCGGA
>probe:Drosophila_2:1632417_a_at:570:169; Interrogation_Position=987; Antisense; AAAGGACCGCATGTGCGTGTGACAT

Paste this into a BLAST search page for me
GTGACATGCAACCAGTATGCCACATTATGCCACATGGTTTTATTTCGAATTTTTATTCTCTGCATCTTAATCTGAGTTCTTCAAGAATGCCGTGGACATCGCCAACAAATGTACGCCCGACGGGATTGAGCTGGTGGAGACGCCATCTACAGACGCCATCTACTAAGTCACCTTGGCTGCAGCGCATTCCAAAGAGTATTAAGAGTATTCGACGCTTCTTCTGGCGGACCACGACCTTCGATTGGCATCGATCGCTGTCTGTGTACCATATGTAATTTAGCCATACTGCAATCTACCATATAATCATTTCTTACTTTTACTCGGAAAAGGACCGCATGTGCGTGTGACAT

Full Affymetrix probeset data:

Annotations for 1632417_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime