FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632419_at:

>probe:Drosophila_2:1632419_at:437:447; Interrogation_Position=180; Antisense; GATGCCGCCGGCAATTAACCGAGAC
>probe:Drosophila_2:1632419_at:644:411; Interrogation_Position=200; Antisense; GAGACTTTGAGTCCCTGGAACACCT
>probe:Drosophila_2:1632419_at:373:281; Interrogation_Position=237; Antisense; CTCCGATGGCCTGGATGAGCAGCTA
>probe:Drosophila_2:1632419_at:629:347; Interrogation_Position=332; Antisense; GCATCCACCTGAACAGTGCCAATAG
>probe:Drosophila_2:1632419_at:724:505; Interrogation_Position=347; Antisense; GTGCCAATAGCAACCTCGGCTTTAT
>probe:Drosophila_2:1632419_at:130:571; Interrogation_Position=364; Antisense; GGCTTTATCGACTCGGATACGCCTA
>probe:Drosophila_2:1632419_at:678:541; Interrogation_Position=378; Antisense; GGATACGCCTAATACGCCGGTGACC
>probe:Drosophila_2:1632419_at:140:499; Interrogation_Position=474; Antisense; GTCGTCCAACCGCAAGGATTCCAAA
>probe:Drosophila_2:1632419_at:173:463; Interrogation_Position=490; Antisense; GATTCCAAAGGCTCCATACTATCAC
>probe:Drosophila_2:1632419_at:260:103; Interrogation_Position=518; Antisense; AGAGCGGCAAGAGTCGGGTTTCCCT
>probe:Drosophila_2:1632419_at:401:197; Interrogation_Position=551; Antisense; AACGTGGACTGCGAATGACGGCCTC
>probe:Drosophila_2:1632419_at:366:611; Interrogation_Position=566; Antisense; TGACGGCCTCGTTTCTGCGAAGGAA
>probe:Drosophila_2:1632419_at:182:611; Interrogation_Position=601; Antisense; TACGAAGAATTGAAGGCCCCACCCG
>probe:Drosophila_2:1632419_at:303:557; Interrogation_Position=641; Antisense; GGACTGACCCAGATTGCATGAGCCA

Paste this into a BLAST search page for me
GATGCCGCCGGCAATTAACCGAGACGAGACTTTGAGTCCCTGGAACACCTCTCCGATGGCCTGGATGAGCAGCTAGCATCCACCTGAACAGTGCCAATAGGTGCCAATAGCAACCTCGGCTTTATGGCTTTATCGACTCGGATACGCCTAGGATACGCCTAATACGCCGGTGACCGTCGTCCAACCGCAAGGATTCCAAAGATTCCAAAGGCTCCATACTATCACAGAGCGGCAAGAGTCGGGTTTCCCTAACGTGGACTGCGAATGACGGCCTCTGACGGCCTCGTTTCTGCGAAGGAATACGAAGAATTGAAGGCCCCACCCGGGACTGACCCAGATTGCATGAGCCA

Full Affymetrix probeset data:

Annotations for 1632419_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720