FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632421_at:

>probe:Drosophila_2:1632421_at:133:667; Interrogation_Position=1026; Antisense; TACAGTGACCAGTATCAGCGCGAGA
>probe:Drosophila_2:1632421_at:273:465; Interrogation_Position=1081; Antisense; GATTGCGCCATAGACAGGACGGAAT
>probe:Drosophila_2:1632421_at:233:15; Interrogation_Position=1126; Antisense; ATTAGCTATAACGTTGCCCATGCAT
>probe:Drosophila_2:1632421_at:407:321; Interrogation_Position=1141; Antisense; GCCCATGCATTTAGCTGTGATTTGA
>probe:Drosophila_2:1632421_at:445:709; Interrogation_Position=1167; Antisense; TTAAGACCAGACATACCTGCACGCT
>probe:Drosophila_2:1632421_at:379:321; Interrogation_Position=1192; Antisense; GCCCAGAGACTCACACCTATATAAA
>probe:Drosophila_2:1632421_at:27:609; Interrogation_Position=698; Antisense; TGAGGTACACAACCACACCATGGAG
>probe:Drosophila_2:1632421_at:585:371; Interrogation_Position=758; Antisense; GAAGTACGATTTGATCATCTCCAAT
>probe:Drosophila_2:1632421_at:8:39; Interrogation_Position=774; Antisense; ATCTCCAATCCTCCGTATGTGAAAA
>probe:Drosophila_2:1632421_at:274:77; Interrogation_Position=802; Antisense; AGGAGTTTCAGTTTCTGCATCCCGA
>probe:Drosophila_2:1632421_at:556:641; Interrogation_Position=815; Antisense; TCTGCATCCCGAAGTCGTGGTGTAT
>probe:Drosophila_2:1632421_at:543:55; Interrogation_Position=838; Antisense; ATGAGAACCTTAATGCCCTGGACGG
>probe:Drosophila_2:1632421_at:288:253; Interrogation_Position=932; Antisense; CAAGCTCTGGCTGGAACTGGGCAAC
>probe:Drosophila_2:1632421_at:118:669; Interrogation_Position=996; Antisense; TACGAGGGCCGGCTCAAGTTCATCG

Paste this into a BLAST search page for me
TACAGTGACCAGTATCAGCGCGAGAGATTGCGCCATAGACAGGACGGAATATTAGCTATAACGTTGCCCATGCATGCCCATGCATTTAGCTGTGATTTGATTAAGACCAGACATACCTGCACGCTGCCCAGAGACTCACACCTATATAAATGAGGTACACAACCACACCATGGAGGAAGTACGATTTGATCATCTCCAATATCTCCAATCCTCCGTATGTGAAAAAGGAGTTTCAGTTTCTGCATCCCGATCTGCATCCCGAAGTCGTGGTGTATATGAGAACCTTAATGCCCTGGACGGCAAGCTCTGGCTGGAACTGGGCAACTACGAGGGCCGGCTCAAGTTCATCG

Full Affymetrix probeset data:

Annotations for 1632421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720