Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632423_at:

>probe:Drosophila_2:1632423_at:493:163; Interrogation_Position=2077; Antisense; AAATATGGGCGTGTCAGTTTTGTGC
>probe:Drosophila_2:1632423_at:535:573; Interrogation_Position=2110; Antisense; GGCGTCGCAACATGGGTTCCGCTGC
>probe:Drosophila_2:1632423_at:34:721; Interrogation_Position=2126; Antisense; TTCCGCTGCGTCTTTATCTCTAGAA
>probe:Drosophila_2:1632423_at:425:335; Interrogation_Position=2130; Antisense; GCTGCGTCTTTATCTCTAGAATATG
>probe:Drosophila_2:1632423_at:24:61; Interrogation_Position=2152; Antisense; ATGTATGCTAAATCTCAACCTTCTA
>probe:Drosophila_2:1632423_at:377:663; Interrogation_Position=2182; Antisense; TAAAGTTTCTGATATCTCGTCGTTC
>probe:Drosophila_2:1632423_at:52:715; Interrogation_Position=2188; Antisense; TTCTGATATCTCGTCGTTCATACGG
>probe:Drosophila_2:1632423_at:468:403; Interrogation_Position=2225; Antisense; GACTAGATCGACTCGGCTATTGATT
>probe:Drosophila_2:1632423_at:144:677; Interrogation_Position=2294; Antisense; TAGTCGGAAACGCTTTCTTCTGCAT
>probe:Drosophila_2:1632423_at:544:391; Interrogation_Position=2300; Antisense; GAAACGCTTTCTTCTGCATGTTACA
>probe:Drosophila_2:1632423_at:27:343; Interrogation_Position=2305; Antisense; GCTTTCTTCTGCATGTTACATACTT
>probe:Drosophila_2:1632423_at:332:465; Interrogation_Position=2408; Antisense; GTTGAAAATGTCTACACTACGATCG
>probe:Drosophila_2:1632423_at:571:497; Interrogation_Position=2417; Antisense; GTCTACACTACGATCGATTATTGAA
>probe:Drosophila_2:1632423_at:568:609; Interrogation_Position=2504; Antisense; TGACTATTTATAGTACCGGATAATA

Paste this into a BLAST search page for me
AAATATGGGCGTGTCAGTTTTGTGCGGCGTCGCAACATGGGTTCCGCTGCTTCCGCTGCGTCTTTATCTCTAGAAGCTGCGTCTTTATCTCTAGAATATGATGTATGCTAAATCTCAACCTTCTATAAAGTTTCTGATATCTCGTCGTTCTTCTGATATCTCGTCGTTCATACGGGACTAGATCGACTCGGCTATTGATTTAGTCGGAAACGCTTTCTTCTGCATGAAACGCTTTCTTCTGCATGTTACAGCTTTCTTCTGCATGTTACATACTTGTTGAAAATGTCTACACTACGATCGGTCTACACTACGATCGATTATTGAATGACTATTTATAGTACCGGATAATA

Full Affymetrix probeset data:

Annotations for 1632423_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime