FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632424_at:

>probe:Drosophila_2:1632424_at:50:29; Interrogation_Position=2854; Antisense; ATACATACGCGACTACATACAAATA
>probe:Drosophila_2:1632424_at:270:481; Interrogation_Position=2952; Antisense; GTATTGTATACATATTCTTCGACTT
>probe:Drosophila_2:1632424_at:393:157; Interrogation_Position=3028; Antisense; ACACGGTGTATAGGGCAATTCAAGC
>probe:Drosophila_2:1632424_at:408:119; Interrogation_Position=3050; Antisense; AGCTGCTGGATATATTCGCGTTTCA
>probe:Drosophila_2:1632424_at:666:9; Interrogation_Position=3063; Antisense; ATTCGCGTTTCAGATGCCAGAGCCA
>probe:Drosophila_2:1632424_at:521:415; Interrogation_Position=3082; Antisense; GAGCCACCCAAAGGATCGGACTCTG
>probe:Drosophila_2:1632424_at:524:639; Interrogation_Position=3097; Antisense; TCGGACTCTGGATCGGGTTTCATTT
>probe:Drosophila_2:1632424_at:704:539; Interrogation_Position=3112; Antisense; GGTTTCATTTCACTCCATTCAGTGG
>probe:Drosophila_2:1632424_at:491:5; Interrogation_Position=3128; Antisense; ATTCAGTGGCGACCGTTTCCTAATT
>probe:Drosophila_2:1632424_at:58:179; Interrogation_Position=3157; Antisense; AAACTTTTGTACATGCTCCGCTGCG
>probe:Drosophila_2:1632424_at:320:539; Interrogation_Position=3206; Antisense; GGTTTTTCGTTCAATCCTTGGAGCA
>probe:Drosophila_2:1632424_at:436:419; Interrogation_Position=3226; Antisense; GAGCATCTTGTTTAGAGCCATCTGA
>probe:Drosophila_2:1632424_at:47:115; Interrogation_Position=3254; Antisense; AGCAGCTGCTATTACCGCCTTGGAA
>probe:Drosophila_2:1632424_at:721:599; Interrogation_Position=3323; Antisense; TGTACTTTACAAATCGTCATCGAAA

Paste this into a BLAST search page for me
ATACATACGCGACTACATACAAATAGTATTGTATACATATTCTTCGACTTACACGGTGTATAGGGCAATTCAAGCAGCTGCTGGATATATTCGCGTTTCAATTCGCGTTTCAGATGCCAGAGCCAGAGCCACCCAAAGGATCGGACTCTGTCGGACTCTGGATCGGGTTTCATTTGGTTTCATTTCACTCCATTCAGTGGATTCAGTGGCGACCGTTTCCTAATTAAACTTTTGTACATGCTCCGCTGCGGGTTTTTCGTTCAATCCTTGGAGCAGAGCATCTTGTTTAGAGCCATCTGAAGCAGCTGCTATTACCGCCTTGGAATGTACTTTACAAATCGTCATCGAAA

Full Affymetrix probeset data:

Annotations for 1632424_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720