FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632425_at:

>probe:Drosophila_2:1632425_at:563:345; Interrogation_Position=124; Antisense; GCATTTGCTAAAGACCTGCCAGCGA
>probe:Drosophila_2:1632425_at:192:461; Interrogation_Position=147; Antisense; GATTAACACGATGGATCCACTCCGC
>probe:Drosophila_2:1632425_at:511:631; Interrogation_Position=167; Antisense; TCCGCCGTAATCCTCTTTTGGAAAT
>probe:Drosophila_2:1632425_at:699:15; Interrogation_Position=227; Antisense; ATTTTCCGACTGGATTGTGTGCCCG
>probe:Drosophila_2:1632425_at:597:283; Interrogation_Position=251; Antisense; GCTGCTTAACTCTTTGGGCCGGAAA
>probe:Drosophila_2:1632425_at:288:557; Interrogation_Position=289; Antisense; GGACTGAGACTGACCGTGGACCAAT
>probe:Drosophila_2:1632425_at:73:227; Interrogation_Position=316; Antisense; AAGGCTTTCCTTGTGAACATTGCTC
>probe:Drosophila_2:1632425_at:465:635; Interrogation_Position=339; Antisense; TCGCTGTTCGGATGCCCAGGATAAG
>probe:Drosophila_2:1632425_at:573:127; Interrogation_Position=379; Antisense; ACCTTTCAACGCGTGATTGCCGAGG
>probe:Drosophila_2:1632425_at:602:317; Interrogation_Position=397; Antisense; GCCGAGGTGAGATTGCAGCGCCAAC
>probe:Drosophila_2:1632425_at:312:95; Interrogation_Position=443; Antisense; AGATTCGCCAGCAGTTACAGCTTTC
>probe:Drosophila_2:1632425_at:455:649; Interrogation_Position=473; Antisense; TCACCGGTTCCTTCTATGACAAAAA
>probe:Drosophila_2:1632425_at:369:671; Interrogation_Position=596; Antisense; TACCCACCATTTCGTCAGAGATCAA
>probe:Drosophila_2:1632425_at:285:521; Interrogation_Position=72; Antisense; GTGGCCCGTTTTCAAGACTATCGAA

Paste this into a BLAST search page for me
GCATTTGCTAAAGACCTGCCAGCGAGATTAACACGATGGATCCACTCCGCTCCGCCGTAATCCTCTTTTGGAAATATTTTCCGACTGGATTGTGTGCCCGGCTGCTTAACTCTTTGGGCCGGAAAGGACTGAGACTGACCGTGGACCAATAAGGCTTTCCTTGTGAACATTGCTCTCGCTGTTCGGATGCCCAGGATAAGACCTTTCAACGCGTGATTGCCGAGGGCCGAGGTGAGATTGCAGCGCCAACAGATTCGCCAGCAGTTACAGCTTTCTCACCGGTTCCTTCTATGACAAAAATACCCACCATTTCGTCAGAGATCAAGTGGCCCGTTTTCAAGACTATCGAA

Full Affymetrix probeset data:

Annotations for 1632425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720