FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632428_at:

>probe:Drosophila_2:1632428_at:288:705; Interrogation_Position=192; Antisense; TTATCTGCCTCCAGAACCAGTGACC
>probe:Drosophila_2:1632428_at:95:83; Interrogation_Position=210; Antisense; AGTGACCGTTCGTGAGGCTCCTGTG
>probe:Drosophila_2:1632428_at:498:609; Interrogation_Position=233; Antisense; TGACCGTGCCTCCTCCAGTTTATTT
>probe:Drosophila_2:1632428_at:113:91; Interrogation_Position=249; Antisense; AGTTTATTTGCCACCAGCGACCGTG
>probe:Drosophila_2:1632428_at:151:121; Interrogation_Position=264; Antisense; AGCGACCGTGAAACCTGAGATCCCG
>probe:Drosophila_2:1632428_at:453:269; Interrogation_Position=278; Antisense; CTGAGATCCCGGTTGTCAGGACCCC
>probe:Drosophila_2:1632428_at:184:1; Interrogation_Position=333; Antisense; AGTGATTAAGGTCAACCCACCCAAG
>probe:Drosophila_2:1632428_at:390:127; Interrogation_Position=582; Antisense; ACCTGTGGTGGAGCAGCCCCGTTAC
>probe:Drosophila_2:1632428_at:369:303; Interrogation_Position=600; Antisense; CCGTTACGTCGCACCAGCTGTAGTG
>probe:Drosophila_2:1632428_at:686:707; Interrogation_Position=631; Antisense; TTCAAGATCCCGATCCCTTCATACG
>probe:Drosophila_2:1632428_at:391:713; Interrogation_Position=648; Antisense; TTCATACGCCGCACCTCTGGAGGAA
>probe:Drosophila_2:1632428_at:587:545; Interrogation_Position=666; Antisense; GGAGGAACCCGTAAACACCTATCTG
>probe:Drosophila_2:1632428_at:170:133; Interrogation_Position=693; Antisense; ACCCCAGGAGATCGTGGAGTCCCAT
>probe:Drosophila_2:1632428_at:426:57; Interrogation_Position=719; Antisense; ATGATGGATACCACTACGATGCGCC

Paste this into a BLAST search page for me
TTATCTGCCTCCAGAACCAGTGACCAGTGACCGTTCGTGAGGCTCCTGTGTGACCGTGCCTCCTCCAGTTTATTTAGTTTATTTGCCACCAGCGACCGTGAGCGACCGTGAAACCTGAGATCCCGCTGAGATCCCGGTTGTCAGGACCCCAGTGATTAAGGTCAACCCACCCAAGACCTGTGGTGGAGCAGCCCCGTTACCCGTTACGTCGCACCAGCTGTAGTGTTCAAGATCCCGATCCCTTCATACGTTCATACGCCGCACCTCTGGAGGAAGGAGGAACCCGTAAACACCTATCTGACCCCAGGAGATCGTGGAGTCCCATATGATGGATACCACTACGATGCGCC

Full Affymetrix probeset data:

Annotations for 1632428_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720