FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632429_at:

>probe:Drosophila_2:1632429_at:225:605; Interrogation_Position=1025; Antisense; TGAGTCTTAACGAGCCTCTGGCAAA
>probe:Drosophila_2:1632429_at:7:359; Interrogation_Position=1045; Antisense; GCAAAGGCTTAACCAGTATACCCAC
>probe:Drosophila_2:1632429_at:235:485; Interrogation_Position=1104; Antisense; GTATGCTCTGTGTACTCGTATTTAA
>probe:Drosophila_2:1632429_at:304:33; Interrogation_Position=1128; Antisense; ATAATTCATGTTTCTGACCGACCGC
>probe:Drosophila_2:1632429_at:37:315; Interrogation_Position=1155; Antisense; GCCTATCTCCCTAGTACTATTTTTG
>probe:Drosophila_2:1632429_at:288:163; Interrogation_Position=1194; Antisense; AAATTTTGCACGCAACCGCTGCTGG
>probe:Drosophila_2:1632429_at:138:133; Interrogation_Position=1208; Antisense; ACCGCTGCTGGCTTTTGCAACAGAA
>probe:Drosophila_2:1632429_at:704:105; Interrogation_Position=1333; Antisense; AGACATAATTTCCTGCACCATCGAA
>probe:Drosophila_2:1632429_at:359:307; Interrogation_Position=1350; Antisense; CCATCGAATTGGCTACTCTATTGTA
>probe:Drosophila_2:1632429_at:415:645; Interrogation_Position=1366; Antisense; TCTATTGTAATTGGCTGAGCTCCAC
>probe:Drosophila_2:1632429_at:302:333; Interrogation_Position=1379; Antisense; GCTGAGCTCCACAAAACTTCTTTAT
>probe:Drosophila_2:1632429_at:445:481; Interrogation_Position=1471; Antisense; GTATTCCATGTAAAATTGCTCCTTG
>probe:Drosophila_2:1632429_at:419:5; Interrogation_Position=1485; Antisense; ATTGCTCCTTGTTTTTGGTAATACA
>probe:Drosophila_2:1632429_at:330:361; Interrogation_Position=1564; Antisense; GAATTCTCATGCTCTTTGGTTTAAT

Paste this into a BLAST search page for me
TGAGTCTTAACGAGCCTCTGGCAAAGCAAAGGCTTAACCAGTATACCCACGTATGCTCTGTGTACTCGTATTTAAATAATTCATGTTTCTGACCGACCGCGCCTATCTCCCTAGTACTATTTTTGAAATTTTGCACGCAACCGCTGCTGGACCGCTGCTGGCTTTTGCAACAGAAAGACATAATTTCCTGCACCATCGAACCATCGAATTGGCTACTCTATTGTATCTATTGTAATTGGCTGAGCTCCACGCTGAGCTCCACAAAACTTCTTTATGTATTCCATGTAAAATTGCTCCTTGATTGCTCCTTGTTTTTGGTAATACAGAATTCTCATGCTCTTTGGTTTAAT

Full Affymetrix probeset data:

Annotations for 1632429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720