Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632430_at:

>probe:Drosophila_2:1632430_at:509:529; Interrogation_Position=1444; Antisense; GGGAGGCTCTCCAGAAGGCCAGCAT
>probe:Drosophila_2:1632430_at:10:423; Interrogation_Position=1479; Antisense; GAGAATTGCGAACGATCCCGTGCTG
>probe:Drosophila_2:1632430_at:612:621; Interrogation_Position=1499; Antisense; TGCTGCTGCCGCCTTGTTGAACAAG
>probe:Drosophila_2:1632430_at:439:467; Interrogation_Position=1514; Antisense; GTTGAACAAGCGACGTGGCCTGGAC
>probe:Drosophila_2:1632430_at:597:581; Interrogation_Position=1529; Antisense; TGGCCTGGACGCTTGTCGTGTCTCA
>probe:Drosophila_2:1632430_at:480:515; Interrogation_Position=1546; Antisense; GTGTCTCATCCAGCGACGATGGAGA
>probe:Drosophila_2:1632430_at:470:109; Interrogation_Position=1600; Antisense; AGAAGCACAAGGACGCGCAGCTGGT
>probe:Drosophila_2:1632430_at:502:719; Interrogation_Position=1659; Antisense; TTCCGTGACTGCAACGTGGACGTAC
>probe:Drosophila_2:1632430_at:132:615; Interrogation_Position=1741; Antisense; TGAAGCATCTGTTCTCGCTGATCTC
>probe:Drosophila_2:1632430_at:336:285; Interrogation_Position=1758; Antisense; CTGATCTCGGACAAGTTTGGTGCCC
>probe:Drosophila_2:1632430_at:370:207; Interrogation_Position=1788; Antisense; AAGCTGGTGGATGTTTTCGCTCTGT
>probe:Drosophila_2:1632430_at:80:285; Interrogation_Position=1809; Antisense; CTGTTCGGCGAATTCCAGAAGGGCA
>probe:Drosophila_2:1632430_at:448:155; Interrogation_Position=1914; Antisense; ACAGATCTCCAGTGCAATGCTAACA
>probe:Drosophila_2:1632430_at:171:687; Interrogation_Position=1964; Antisense; TATACTACTAGATCCCACTATCTGC

Paste this into a BLAST search page for me
GGGAGGCTCTCCAGAAGGCCAGCATGAGAATTGCGAACGATCCCGTGCTGTGCTGCTGCCGCCTTGTTGAACAAGGTTGAACAAGCGACGTGGCCTGGACTGGCCTGGACGCTTGTCGTGTCTCAGTGTCTCATCCAGCGACGATGGAGAAGAAGCACAAGGACGCGCAGCTGGTTTCCGTGACTGCAACGTGGACGTACTGAAGCATCTGTTCTCGCTGATCTCCTGATCTCGGACAAGTTTGGTGCCCAAGCTGGTGGATGTTTTCGCTCTGTCTGTTCGGCGAATTCCAGAAGGGCAACAGATCTCCAGTGCAATGCTAACATATACTACTAGATCCCACTATCTGC

Full Affymetrix probeset data:

Annotations for 1632430_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime