Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632432_at:

>probe:Drosophila_2:1632432_at:344:481; Interrogation_Position=4110; Antisense; GTTTGGAACTGGCACGCAGACGTCA
>probe:Drosophila_2:1632432_at:308:409; Interrogation_Position=4128; Antisense; GACGTCACTGCCATCGAAATTGGAA
>probe:Drosophila_2:1632432_at:688:649; Interrogation_Position=4201; Antisense; TACTCTGTACGAAACCCTATTGATT
>probe:Drosophila_2:1632432_at:495:727; Interrogation_Position=4225; Antisense; TTGTTGTTAGTTCTAGCCGCAGCTA
>probe:Drosophila_2:1632432_at:297:167; Interrogation_Position=4260; Antisense; AAATGATTGCCTGTTTGCTGAGGGC
>probe:Drosophila_2:1632432_at:53:609; Interrogation_Position=4278; Antisense; TGAGGGCAACGCAGCAGCCAGCAAT
>probe:Drosophila_2:1632432_at:367:307; Interrogation_Position=4295; Antisense; CCAGCAATGTTGTTATGTTCAGTAC
>probe:Drosophila_2:1632432_at:492:179; Interrogation_Position=4392; Antisense; AAAACTTCATCTACACATGCACGCA
>probe:Drosophila_2:1632432_at:258:153; Interrogation_Position=4406; Antisense; ACATGCACGCACTTTCGGCAGACAA
>probe:Drosophila_2:1632432_at:200:131; Interrogation_Position=4430; Antisense; ACCTAAATTATTTCTTGAGCCACAA
>probe:Drosophila_2:1632432_at:572:655; Interrogation_Position=4476; Antisense; TAATAATCCCACTTTCCAATGTGAT
>probe:Drosophila_2:1632432_at:257:257; Interrogation_Position=4531; Antisense; CAAATATTTATCGTTTCCTGTTGGG
>probe:Drosophila_2:1632432_at:392:455; Interrogation_Position=4580; Antisense; GATAATATACTTACCTTGCCGCACT
>probe:Drosophila_2:1632432_at:229:723; Interrogation_Position=4595; Antisense; TTGCCGCACTTTGCCTGCAGAAAAC

Paste this into a BLAST search page for me
GTTTGGAACTGGCACGCAGACGTCAGACGTCACTGCCATCGAAATTGGAATACTCTGTACGAAACCCTATTGATTTTGTTGTTAGTTCTAGCCGCAGCTAAAATGATTGCCTGTTTGCTGAGGGCTGAGGGCAACGCAGCAGCCAGCAATCCAGCAATGTTGTTATGTTCAGTACAAAACTTCATCTACACATGCACGCAACATGCACGCACTTTCGGCAGACAAACCTAAATTATTTCTTGAGCCACAATAATAATCCCACTTTCCAATGTGATCAAATATTTATCGTTTCCTGTTGGGGATAATATACTTACCTTGCCGCACTTTGCCGCACTTTGCCTGCAGAAAAC

Full Affymetrix probeset data:

Annotations for 1632432_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime