Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632433_at:

>probe:Drosophila_2:1632433_at:522:275; Interrogation_Position=2037; Antisense; CTTCACTGGAGCAAGTTCACATTCA
>probe:Drosophila_2:1632433_at:611:711; Interrogation_Position=2052; Antisense; TTCACATTCAGAACGCGGATTCAGC
>probe:Drosophila_2:1632433_at:441:649; Interrogation_Position=2072; Antisense; TCAGCGGAAGGCGAATCCAGCAAGG
>probe:Drosophila_2:1632433_at:672:505; Interrogation_Position=2125; Antisense; GTCCACGACGAGACAGCAGTCACAG
>probe:Drosophila_2:1632433_at:661:159; Interrogation_Position=2176; Antisense; ACAACAGAAGGGTCGCAAGGGCAAA
>probe:Drosophila_2:1632433_at:50:167; Interrogation_Position=2198; Antisense; AAAGGCAAGCACTAGGACGAAGGTA
>probe:Drosophila_2:1632433_at:434:259; Interrogation_Position=2227; Antisense; CACCCAGGCCGATACATTAGTCGTA
>probe:Drosophila_2:1632433_at:207:675; Interrogation_Position=2254; Antisense; TAGACTAAGCAATATTCGAACGGAT
>probe:Drosophila_2:1632433_at:342:383; Interrogation_Position=2271; Antisense; GAACGGATATGGATGCGGCTGAAAT
>probe:Drosophila_2:1632433_at:643:51; Interrogation_Position=2283; Antisense; ATGCGGCTGAAATGGGCACATCTAT
>probe:Drosophila_2:1632433_at:646:21; Interrogation_Position=2306; Antisense; ATATTTGTTTTTACACTCCACACGA
>probe:Drosophila_2:1632433_at:305:121; Interrogation_Position=2486; Antisense; AGCCCAATAGTAACGGAGGCGATAT
>probe:Drosophila_2:1632433_at:388:547; Interrogation_Position=2500; Antisense; GGAGGCGATATTTTCAATAACGCAA
>probe:Drosophila_2:1632433_at:217:333; Interrogation_Position=2570; Antisense; GCTGCGTATAACATAAGCCAACTAT

Paste this into a BLAST search page for me
CTTCACTGGAGCAAGTTCACATTCATTCACATTCAGAACGCGGATTCAGCTCAGCGGAAGGCGAATCCAGCAAGGGTCCACGACGAGACAGCAGTCACAGACAACAGAAGGGTCGCAAGGGCAAAAAAGGCAAGCACTAGGACGAAGGTACACCCAGGCCGATACATTAGTCGTATAGACTAAGCAATATTCGAACGGATGAACGGATATGGATGCGGCTGAAATATGCGGCTGAAATGGGCACATCTATATATTTGTTTTTACACTCCACACGAAGCCCAATAGTAACGGAGGCGATATGGAGGCGATATTTTCAATAACGCAAGCTGCGTATAACATAAGCCAACTAT

Full Affymetrix probeset data:

Annotations for 1632433_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime