FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632434_at:

>probe:Drosophila_2:1632434_at:440:47; Interrogation_Position=2713; Antisense; ATCCGGTCGCATTGATCGCTTGGTG
>probe:Drosophila_2:1632434_at:596:5; Interrogation_Position=2723; Antisense; ATTGATCGCTTGGTGGAGTGTCCTT
>probe:Drosophila_2:1632434_at:218:549; Interrogation_Position=2737; Antisense; GGAGTGTCCTTTGCCGGATGCTCCG
>probe:Drosophila_2:1632434_at:264:447; Interrogation_Position=2753; Antisense; GATGCTCCGGCCAGAGTACGTATAT
>probe:Drosophila_2:1632434_at:296:489; Interrogation_Position=2768; Antisense; GTACGTATATTTGAAGCACTCAGTT
>probe:Drosophila_2:1632434_at:401:143; Interrogation_Position=2797; Antisense; ACTGAGCCTTGATGAGTGCGTGGAC
>probe:Drosophila_2:1632434_at:99:585; Interrogation_Position=2817; Antisense; TGGACTTCGATTGGTTTGCGGGAAA
>probe:Drosophila_2:1632434_at:481:181; Interrogation_Position=2840; Antisense; AAAACTGCAAACTACACTGGCGCCG
>probe:Drosophila_2:1632434_at:30:103; Interrogation_Position=2871; Antisense; AGAGCATCCTGACCTCGGCGAACAT
>probe:Drosophila_2:1632434_at:255:71; Interrogation_Position=2910; Antisense; AGGCGCTAGCTCAATTCGGACACGA
>probe:Drosophila_2:1632434_at:649:243; Interrogation_Position=2950; Antisense; AATTTCCTTGAAGCAGAAGCACCTG
>probe:Drosophila_2:1632434_at:138:377; Interrogation_Position=2965; Antisense; GAAGCACCTGATTGAGTCGTTCCAA
>probe:Drosophila_2:1632434_at:713:463; Interrogation_Position=2974; Antisense; GATTGAGTCGTTCCAAACCACTCGT
>probe:Drosophila_2:1632434_at:2:411; Interrogation_Position=3199; Antisense; GACGCAAGTCTTAGGTAGTACATAT

Paste this into a BLAST search page for me
ATCCGGTCGCATTGATCGCTTGGTGATTGATCGCTTGGTGGAGTGTCCTTGGAGTGTCCTTTGCCGGATGCTCCGGATGCTCCGGCCAGAGTACGTATATGTACGTATATTTGAAGCACTCAGTTACTGAGCCTTGATGAGTGCGTGGACTGGACTTCGATTGGTTTGCGGGAAAAAAACTGCAAACTACACTGGCGCCGAGAGCATCCTGACCTCGGCGAACATAGGCGCTAGCTCAATTCGGACACGAAATTTCCTTGAAGCAGAAGCACCTGGAAGCACCTGATTGAGTCGTTCCAAGATTGAGTCGTTCCAAACCACTCGTGACGCAAGTCTTAGGTAGTACATAT

Full Affymetrix probeset data:

Annotations for 1632434_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720