Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632435_at:

>probe:Drosophila_2:1632435_at:552:141; Interrogation_Position=1165; Antisense; ACTGTTCCAGACCAACAACTACAAC
>probe:Drosophila_2:1632435_at:550:185; Interrogation_Position=1199; Antisense; AACAACTTTAAGATGCAACCGGCCA
>probe:Drosophila_2:1632435_at:623:615; Interrogation_Position=1212; Antisense; TGCAACCGGCCAACAACTTTAGAAT
>probe:Drosophila_2:1632435_at:612:147; Interrogation_Position=1227; Antisense; ACTTTAGAATGCACCCAGCCAACAA
>probe:Drosophila_2:1632435_at:488:127; Interrogation_Position=1243; Antisense; AGCCAACAACTTTAGCATGCATTCA
>probe:Drosophila_2:1632435_at:461:53; Interrogation_Position=1259; Antisense; ATGCATTCATTTAATCCACATGGTT
>probe:Drosophila_2:1632435_at:272:269; Interrogation_Position=1277; Antisense; CATGGTTACCAAATGAATCGCGTCA
>probe:Drosophila_2:1632435_at:53:237; Interrogation_Position=1292; Antisense; AATCGCGTCATGAACTAGACCCACA
>probe:Drosophila_2:1632435_at:609:193; Interrogation_Position=1337; Antisense; AACTGTTGGATATGCCCAACCTGCA
>probe:Drosophila_2:1632435_at:239:675; Interrogation_Position=1367; Antisense; TAGTCTTCAACTCCCAGGCATCGAG
>probe:Drosophila_2:1632435_at:636:199; Interrogation_Position=1399; Antisense; AACCAGCTGGTCGAGTTGGTACCCA
>probe:Drosophila_2:1632435_at:680:465; Interrogation_Position=1413; Antisense; GTTGGTACCCAATAATGTGATGCTG
>probe:Drosophila_2:1632435_at:409:513; Interrogation_Position=1429; Antisense; GTGATGCTGTCGCTCATACACAAAT
>probe:Drosophila_2:1632435_at:481:271; Interrogation_Position=1655; Antisense; CATACATGCATGCTTACATACTTGT

Paste this into a BLAST search page for me
ACTGTTCCAGACCAACAACTACAACAACAACTTTAAGATGCAACCGGCCATGCAACCGGCCAACAACTTTAGAATACTTTAGAATGCACCCAGCCAACAAAGCCAACAACTTTAGCATGCATTCAATGCATTCATTTAATCCACATGGTTCATGGTTACCAAATGAATCGCGTCAAATCGCGTCATGAACTAGACCCACAAACTGTTGGATATGCCCAACCTGCATAGTCTTCAACTCCCAGGCATCGAGAACCAGCTGGTCGAGTTGGTACCCAGTTGGTACCCAATAATGTGATGCTGGTGATGCTGTCGCTCATACACAAATCATACATGCATGCTTACATACTTGT

Full Affymetrix probeset data:

Annotations for 1632435_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime