FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632438_at:

>probe:Drosophila_2:1632438_at:562:553; Interrogation_Position=1047; Antisense; GGAGCTACCCATTAGAGCGCTGACA
>probe:Drosophila_2:1632438_at:73:409; Interrogation_Position=1081; Antisense; GACGATAAGGAGCTCCCTGACTCAG
>probe:Drosophila_2:1632438_at:24:405; Interrogation_Position=1099; Antisense; GACTCAGACTCTTTGAACGTCGCTC
>probe:Drosophila_2:1632438_at:317:335; Interrogation_Position=1120; Antisense; GCTCCACCGGAAGGCTTTAGCGATG
>probe:Drosophila_2:1632438_at:81:71; Interrogation_Position=1220; Antisense; AGGCGTGTGCCTAAACTGGTATTAC
>probe:Drosophila_2:1632438_at:701:391; Interrogation_Position=1252; Antisense; GAAAGCTAACCCTAGATGTTGCCTA
>probe:Drosophila_2:1632438_at:339:219; Interrogation_Position=753; Antisense; AAGTCATCTCGATCTTTTGCGCAAC
>probe:Drosophila_2:1632438_at:168:29; Interrogation_Position=813; Antisense; ATACGGCATTAATCCCAATCAGCTG
>probe:Drosophila_2:1632438_at:477:119; Interrogation_Position=833; Antisense; AGCTGCGCATGTACTTTCATTACCA
>probe:Drosophila_2:1632438_at:425:489; Interrogation_Position=895; Antisense; GTACGGAACGATGCACCGGGCATAT
>probe:Drosophila_2:1632438_at:413:681; Interrogation_Position=917; Antisense; TATGGTGCGAGAAGTCCCACATGCT
>probe:Drosophila_2:1632438_at:351:191; Interrogation_Position=958; Antisense; AACTTGGAGCTGATGCCGGACTACT
>probe:Drosophila_2:1632438_at:453:49; Interrogation_Position=970; Antisense; ATGCCGGACTACTATCAGCGAGCCA
>probe:Drosophila_2:1632438_at:273:317; Interrogation_Position=999; Antisense; GCCGTTTGTCCTGTACGAAGGCAAT

Paste this into a BLAST search page for me
GGAGCTACCCATTAGAGCGCTGACAGACGATAAGGAGCTCCCTGACTCAGGACTCAGACTCTTTGAACGTCGCTCGCTCCACCGGAAGGCTTTAGCGATGAGGCGTGTGCCTAAACTGGTATTACGAAAGCTAACCCTAGATGTTGCCTAAAGTCATCTCGATCTTTTGCGCAACATACGGCATTAATCCCAATCAGCTGAGCTGCGCATGTACTTTCATTACCAGTACGGAACGATGCACCGGGCATATTATGGTGCGAGAAGTCCCACATGCTAACTTGGAGCTGATGCCGGACTACTATGCCGGACTACTATCAGCGAGCCAGCCGTTTGTCCTGTACGAAGGCAAT

Full Affymetrix probeset data:

Annotations for 1632438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720