Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632439_at:

>probe:Drosophila_2:1632439_at:594:687; Interrogation_Position=1505; Antisense; TTTGGGCGCGACACACAAATTCGAT
>probe:Drosophila_2:1632439_at:633:397; Interrogation_Position=1514; Antisense; GACACACAAATTCGATTCCACCACA
>probe:Drosophila_2:1632439_at:148:161; Interrogation_Position=1521; Antisense; AAATTCGATTCCACCACACGCATTT
>probe:Drosophila_2:1632439_at:595:463; Interrogation_Position=1527; Antisense; GATTCCACCACACGCATTTTTCATT
>probe:Drosophila_2:1632439_at:296:127; Interrogation_Position=1533; Antisense; ACCACACGCATTTTTCATTCTCGGA
>probe:Drosophila_2:1632439_at:214:261; Interrogation_Position=1537; Antisense; CACGCATTTTTCATTCTCGGAATAA
>probe:Drosophila_2:1632439_at:599:643; Interrogation_Position=1547; Antisense; TCATTCTCGGAATAACGTACATATT
>probe:Drosophila_2:1632439_at:478:699; Interrogation_Position=1578; Antisense; TTGTTTTCGTGTTTATGGAATATTT
>probe:Drosophila_2:1632439_at:71:685; Interrogation_Position=1606; Antisense; TATAAATGCATATAGCGGTTGCTCT
>probe:Drosophila_2:1632439_at:148:345; Interrogation_Position=1613; Antisense; GCATATAGCGGTTGCTCTGGCGCGA
>probe:Drosophila_2:1632439_at:552:723; Interrogation_Position=1624; Antisense; TTGCTCTGGCGCGATGGCATCGGTT
>probe:Drosophila_2:1632439_at:98:441; Interrogation_Position=1636; Antisense; GATGGCATCGGTTTAATGTCTGTCA
>probe:Drosophila_2:1632439_at:474:347; Interrogation_Position=1640; Antisense; GCATCGGTTTAATGTCTGTCATTTT
>probe:Drosophila_2:1632439_at:476:229; Interrogation_Position=1650; Antisense; AATGTCTGTCATTTTGTTTAATTTA

Paste this into a BLAST search page for me
TTTGGGCGCGACACACAAATTCGATGACACACAAATTCGATTCCACCACAAAATTCGATTCCACCACACGCATTTGATTCCACCACACGCATTTTTCATTACCACACGCATTTTTCATTCTCGGACACGCATTTTTCATTCTCGGAATAATCATTCTCGGAATAACGTACATATTTTGTTTTCGTGTTTATGGAATATTTTATAAATGCATATAGCGGTTGCTCTGCATATAGCGGTTGCTCTGGCGCGATTGCTCTGGCGCGATGGCATCGGTTGATGGCATCGGTTTAATGTCTGTCAGCATCGGTTTAATGTCTGTCATTTTAATGTCTGTCATTTTGTTTAATTTA

Full Affymetrix probeset data:

Annotations for 1632439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime