FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632440_at:

>probe:Drosophila_2:1632440_at:437:257; Interrogation_Position=262; Antisense; CACTATTGGATTCGTGAAATCTTCT
>probe:Drosophila_2:1632440_at:73:463; Interrogation_Position=270; Antisense; GATTCGTGAAATCTTCTGGTATCAT
>probe:Drosophila_2:1632440_at:456:715; Interrogation_Position=283; Antisense; TTCTGGTATCATCCACTTCAACTAC
>probe:Drosophila_2:1632440_at:659:589; Interrogation_Position=286; Antisense; TGGTATCATCCACTTCAACTACTAC
>probe:Drosophila_2:1632440_at:104:683; Interrogation_Position=289; Antisense; TATCATCCACTTCAACTACTACGCG
>probe:Drosophila_2:1632440_at:423:149; Interrogation_Position=297; Antisense; ACTTCAACTACTACGCGCCCAAGAG
>probe:Drosophila_2:1632440_at:507:671; Interrogation_Position=308; Antisense; TACGCGCCCAAGAGCCTGGACTAAG
>probe:Drosophila_2:1632440_at:132:213; Interrogation_Position=317; Antisense; AAGAGCCTGGACTAAGCCAGCGTTC
>probe:Drosophila_2:1632440_at:681:657; Interrogation_Position=329; Antisense; TAAGCCAGCGTTCCCTTACGTGTAA
>probe:Drosophila_2:1632440_at:390:311; Interrogation_Position=332; Antisense; GCCAGCGTTCCCTTACGTGTAAATT
>probe:Drosophila_2:1632440_at:179:515; Interrogation_Position=348; Antisense; GTGTAAATTAATCCAACATTTGTGT
>probe:Drosophila_2:1632440_at:178:29; Interrogation_Position=376; Antisense; ATAAGCTTAAAGTGGCGACATAGTA
>probe:Drosophila_2:1632440_at:125:577; Interrogation_Position=389; Antisense; GGCGACATAGTAAATCACAGATCCG
>probe:Drosophila_2:1632440_at:724:485; Interrogation_Position=398; Antisense; GTAAATCACAGATCCGAAAGTAATC

Paste this into a BLAST search page for me
CACTATTGGATTCGTGAAATCTTCTGATTCGTGAAATCTTCTGGTATCATTTCTGGTATCATCCACTTCAACTACTGGTATCATCCACTTCAACTACTACTATCATCCACTTCAACTACTACGCGACTTCAACTACTACGCGCCCAAGAGTACGCGCCCAAGAGCCTGGACTAAGAAGAGCCTGGACTAAGCCAGCGTTCTAAGCCAGCGTTCCCTTACGTGTAAGCCAGCGTTCCCTTACGTGTAAATTGTGTAAATTAATCCAACATTTGTGTATAAGCTTAAAGTGGCGACATAGTAGGCGACATAGTAAATCACAGATCCGGTAAATCACAGATCCGAAAGTAATC

Full Affymetrix probeset data:

Annotations for 1632440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720