FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632441_at:

>probe:Drosophila_2:1632441_at:258:497; Interrogation_Position=109; Antisense; GTCTTGGTCTACGACATGGGCAACT
>probe:Drosophila_2:1632441_at:670:725; Interrogation_Position=133; Antisense; TTGGAGACCTTTCAATACTGCCGCT
>probe:Drosophila_2:1632441_at:2:453; Interrogation_Position=171; Antisense; GATCTTGGACAGTTTCAGTCATCGT
>probe:Drosophila_2:1632441_at:95:195; Interrogation_Position=253; Antisense; AACTCGCAGCAGACTTTTACTCAAT
>probe:Drosophila_2:1632441_at:162:669; Interrogation_Position=270; Antisense; TACTCAATACCGAATCCTTTCCATT
>probe:Drosophila_2:1632441_at:627:313; Interrogation_Position=29; Antisense; GCCAGAAGCGATTTCCGGCTGACAA
>probe:Drosophila_2:1632441_at:225:273; Interrogation_Position=317; Antisense; CTTATCCTGAACTGGCCGAATGGCA
>probe:Drosophila_2:1632441_at:476:553; Interrogation_Position=342; Antisense; GGAGCTCAAGGACATTTCCACGCTG
>probe:Drosophila_2:1632441_at:632:177; Interrogation_Position=373; Antisense; AAACATTGGCGCTGCGGCTACGTCG
>probe:Drosophila_2:1632441_at:166:509; Interrogation_Position=399; Antisense; GTGCTCGGCGCAATATAACTACAAA
>probe:Drosophila_2:1632441_at:619:237; Interrogation_Position=423; Antisense; AATCGGAGACGTTTTCCGCGAGCTG
>probe:Drosophila_2:1632441_at:545:573; Interrogation_Position=45; Antisense; GGCTGACAACTTCGCCGAGTGGAAC
>probe:Drosophila_2:1632441_at:612:317; Interrogation_Position=515; Antisense; GCCTGGTTGGCACTGAGTACTCACA
>probe:Drosophila_2:1632441_at:399:197; Interrogation_Position=93; Antisense; AACGGTGCACGCCTATGTCTTGGTC

Paste this into a BLAST search page for me
GTCTTGGTCTACGACATGGGCAACTTTGGAGACCTTTCAATACTGCCGCTGATCTTGGACAGTTTCAGTCATCGTAACTCGCAGCAGACTTTTACTCAATTACTCAATACCGAATCCTTTCCATTGCCAGAAGCGATTTCCGGCTGACAACTTATCCTGAACTGGCCGAATGGCAGGAGCTCAAGGACATTTCCACGCTGAAACATTGGCGCTGCGGCTACGTCGGTGCTCGGCGCAATATAACTACAAAAATCGGAGACGTTTTCCGCGAGCTGGGCTGACAACTTCGCCGAGTGGAACGCCTGGTTGGCACTGAGTACTCACAAACGGTGCACGCCTATGTCTTGGTC

Full Affymetrix probeset data:

Annotations for 1632441_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720