Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632443_at:

>probe:Drosophila_2:1632443_at:181:299; Interrogation_Position=2458; Antisense; CGCTGAACTCCAGGCGCAGCAGTTT
>probe:Drosophila_2:1632443_at:98:361; Interrogation_Position=2523; Antisense; GCAAGGTTCAGGAGGCTGCCTACGA
>probe:Drosophila_2:1632443_at:631:611; Interrogation_Position=2581; Antisense; TGACAAGGCGCAAAGCTCCTACGAT
>probe:Drosophila_2:1632443_at:602:625; Interrogation_Position=2597; Antisense; TCCTACGATGGCTACTACGCTCAAA
>probe:Drosophila_2:1632443_at:695:671; Interrogation_Position=2612; Antisense; TACGCTCAAAAAGCACATGCCGATG
>probe:Drosophila_2:1632443_at:236:441; Interrogation_Position=2633; Antisense; GATGGCACCACTTTGGATGCTTTAA
>probe:Drosophila_2:1632443_at:577:41; Interrogation_Position=2660; Antisense; ATCGATCATGTCTGAGATTTGGCCA
>probe:Drosophila_2:1632443_at:214:597; Interrogation_Position=2672; Antisense; TGAGATTTGGCCAGCGTTTAACGCT
>probe:Drosophila_2:1632443_at:527:327; Interrogation_Position=2685; Antisense; GCGTTTAACGCTGTCACAGATGGTA
>probe:Drosophila_2:1632443_at:552:439; Interrogation_Position=2703; Antisense; GATGGTAAATCAATCCTGGGTTTTT
>probe:Drosophila_2:1632443_at:111:191; Interrogation_Position=2736; Antisense; AAGCAATACCTTATAATCCTTATGA
>probe:Drosophila_2:1632443_at:598:239; Interrogation_Position=2882; Antisense; AATACCTATGTGAATTCGACTTAAG
>probe:Drosophila_2:1632443_at:418:435; Interrogation_Position=2931; Antisense; GAGGTTGCATGTCAAATATCATCTT
>probe:Drosophila_2:1632443_at:669:647; Interrogation_Position=3026; Antisense; TAAATTTGCCCTATTAAGAGCTTAA

Paste this into a BLAST search page for me
CGCTGAACTCCAGGCGCAGCAGTTTGCAAGGTTCAGGAGGCTGCCTACGATGACAAGGCGCAAAGCTCCTACGATTCCTACGATGGCTACTACGCTCAAATACGCTCAAAAAGCACATGCCGATGGATGGCACCACTTTGGATGCTTTAAATCGATCATGTCTGAGATTTGGCCATGAGATTTGGCCAGCGTTTAACGCTGCGTTTAACGCTGTCACAGATGGTAGATGGTAAATCAATCCTGGGTTTTTAAGCAATACCTTATAATCCTTATGAAATACCTATGTGAATTCGACTTAAGGAGGTTGCATGTCAAATATCATCTTTAAATTTGCCCTATTAAGAGCTTAA

Full Affymetrix probeset data:

Annotations for 1632443_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime