FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632444_at:

>probe:Drosophila_2:1632444_at:562:393; Interrogation_Position=1105; Antisense; GAAAGTCCTGGCGAAATCTACATTG
>probe:Drosophila_2:1632444_at:418:369; Interrogation_Position=1132; Antisense; GAATGCGATGAACCGGCTGCACCAT
>probe:Drosophila_2:1632444_at:709:261; Interrogation_Position=1151; Antisense; CACCATGTGTGGTTGTTTCCTTTAA
>probe:Drosophila_2:1632444_at:125:181; Interrogation_Position=1202; Antisense; AAAAATCGGACTTCAGCTGTGCTTC
>probe:Drosophila_2:1632444_at:651:63; Interrogation_Position=1232; Antisense; ATGTGGCCAGTTGTCGACTATGCGA
>probe:Drosophila_2:1632444_at:6:171; Interrogation_Position=1273; Antisense; AAAGGATCATTTCCGGAGGAGCGCC
>probe:Drosophila_2:1632444_at:459:415; Interrogation_Position=1291; Antisense; GAGCGCCTCTGGTGTCATCAGTGTA
>probe:Drosophila_2:1632444_at:642:627; Interrogation_Position=1361; Antisense; TGCCTTGTCCGGCTCGAGCAAATGA
>probe:Drosophila_2:1632444_at:214:3; Interrogation_Position=1401; Antisense; ATTGGCCTGCTTGGAGTACTTTGAC
>probe:Drosophila_2:1632444_at:72:717; Interrogation_Position=1458; Antisense; TTCCAATCCCGAGCTATACTACGAA
>probe:Drosophila_2:1632444_at:684:547; Interrogation_Position=1493; Antisense; GGAGTAACCACTTCGACAGTTGTCG
>probe:Drosophila_2:1632444_at:535:355; Interrogation_Position=1517; Antisense; GCACTTGTCACAGTCAGGCATGCAA
>probe:Drosophila_2:1632444_at:661:269; Interrogation_Position=1535; Antisense; CATGCAATAATAGTCCTGGCCGGGA
>probe:Drosophila_2:1632444_at:65:361; Interrogation_Position=1610; Antisense; GCAAGAGTTCCGCAATATCCATCAA

Paste this into a BLAST search page for me
GAAAGTCCTGGCGAAATCTACATTGGAATGCGATGAACCGGCTGCACCATCACCATGTGTGGTTGTTTCCTTTAAAAAAATCGGACTTCAGCTGTGCTTCATGTGGCCAGTTGTCGACTATGCGAAAAGGATCATTTCCGGAGGAGCGCCGAGCGCCTCTGGTGTCATCAGTGTATGCCTTGTCCGGCTCGAGCAAATGAATTGGCCTGCTTGGAGTACTTTGACTTCCAATCCCGAGCTATACTACGAAGGAGTAACCACTTCGACAGTTGTCGGCACTTGTCACAGTCAGGCATGCAACATGCAATAATAGTCCTGGCCGGGAGCAAGAGTTCCGCAATATCCATCAA

Full Affymetrix probeset data:

Annotations for 1632444_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720