FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632446_at:

>probe:Drosophila_2:1632446_at:102:213; Interrogation_Position=104; Antisense; AAGACGGCGTGATTAGCACCTTCCT
>probe:Drosophila_2:1632446_at:284:245; Interrogation_Position=148; Antisense; AATTATTTTGCCATCCGCTTGGTGA
>probe:Drosophila_2:1632446_at:558:359; Interrogation_Position=245; Antisense; GCAAGAATTGTATCGCGTCGTCCAA
>probe:Drosophila_2:1632446_at:134:33; Interrogation_Position=32; Antisense; ATAAGATCGACCACTGCTTGCTGGG
>probe:Drosophila_2:1632446_at:299:349; Interrogation_Position=357; Antisense; GCAGGCCATTGAAGAGCTCACCAAT
>probe:Drosophila_2:1632446_at:307:649; Interrogation_Position=374; Antisense; TCACCAATCTGCTCGATCAACTGAA
>probe:Drosophila_2:1632446_at:231:681; Interrogation_Position=406; Antisense; TATGAGCCCGTTTCCTATGGACGGA
>probe:Drosophila_2:1632446_at:628:407; Interrogation_Position=425; Antisense; GACGGATAGCCGTGCAGGCTCAACA
>probe:Drosophila_2:1632446_at:274:567; Interrogation_Position=473; Antisense; GGCAGAATTTGCTCAACGGCCGCAA
>probe:Drosophila_2:1632446_at:415:55; Interrogation_Position=497; Antisense; ATGAGCAGTTGGAGCGCCGTTTAGC
>probe:Drosophila_2:1632446_at:593:621; Interrogation_Position=50; Antisense; TGCTGGGCGCAGTTCGCGGCATTAA
>probe:Drosophila_2:1632446_at:306:321; Interrogation_Position=559; Antisense; GCCCGCATGCGCATTTCGAAAAGTT
>probe:Drosophila_2:1632446_at:568:23; Interrogation_Position=599; Antisense; ATATGCGCACTTGGCGTTTCGGCTA
>probe:Drosophila_2:1632446_at:200:45; Interrogation_Position=83; Antisense; ATCGCTCGGTGCGTAATGCCCAAGA

Paste this into a BLAST search page for me
AAGACGGCGTGATTAGCACCTTCCTAATTATTTTGCCATCCGCTTGGTGAGCAAGAATTGTATCGCGTCGTCCAAATAAGATCGACCACTGCTTGCTGGGGCAGGCCATTGAAGAGCTCACCAATTCACCAATCTGCTCGATCAACTGAATATGAGCCCGTTTCCTATGGACGGAGACGGATAGCCGTGCAGGCTCAACAGGCAGAATTTGCTCAACGGCCGCAAATGAGCAGTTGGAGCGCCGTTTAGCTGCTGGGCGCAGTTCGCGGCATTAAGCCCGCATGCGCATTTCGAAAAGTTATATGCGCACTTGGCGTTTCGGCTAATCGCTCGGTGCGTAATGCCCAAGA

Full Affymetrix probeset data:

Annotations for 1632446_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720