FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632447_at:

>probe:Drosophila_2:1632447_at:295:291; Interrogation_Position=552; Antisense; CGTTAGCTGGCAGAGTTTGATGTGC
>probe:Drosophila_2:1632447_at:325:351; Interrogation_Position=561; Antisense; GCAGAGTTTGATGTGCTTTGACTGA
>probe:Drosophila_2:1632447_at:362:63; Interrogation_Position=571; Antisense; ATGTGCTTTGACTGAGAGATTCCCT
>probe:Drosophila_2:1632447_at:217:619; Interrogation_Position=574; Antisense; TGCTTTGACTGAGAGATTCCCTCCT
>probe:Drosophila_2:1632447_at:438:691; Interrogation_Position=577; Antisense; TTTGACTGAGAGATTCCCTCCTCGG
>probe:Drosophila_2:1632447_at:7:557; Interrogation_Position=583; Antisense; TGAGAGATTCCCTCCTCGGCTTGGG
>probe:Drosophila_2:1632447_at:110:571; Interrogation_Position=600; Antisense; GGCTTGGGGCCGAATCTAAAACTGA
>probe:Drosophila_2:1632447_at:177:523; Interrogation_Position=606; Antisense; GGGCCGAATCTAAAACTGAAAGAGA
>probe:Drosophila_2:1632447_at:599:365; Interrogation_Position=629; Antisense; GAATCAAATCTAATTGAATCGCTGT
>probe:Drosophila_2:1632447_at:41:239; Interrogation_Position=635; Antisense; AATCTAATTGAATCGCTGTGAGAAA
>probe:Drosophila_2:1632447_at:277:235; Interrogation_Position=645; Antisense; AATCGCTGTGAGAAAGACAAGCTAG
>probe:Drosophila_2:1632447_at:180:395; Interrogation_Position=660; Antisense; GACAAGCTAGTCTAGTGACCGACCG
>probe:Drosophila_2:1632447_at:590:205; Interrogation_Position=663; Antisense; AAGCTAGTCTAGTGACCGACCGACC
>probe:Drosophila_2:1632447_at:204:277; Interrogation_Position=666; Antisense; CTAGTCTAGTGACCGACCGACCGGT

Paste this into a BLAST search page for me
CGTTAGCTGGCAGAGTTTGATGTGCGCAGAGTTTGATGTGCTTTGACTGAATGTGCTTTGACTGAGAGATTCCCTTGCTTTGACTGAGAGATTCCCTCCTTTTGACTGAGAGATTCCCTCCTCGGTGAGAGATTCCCTCCTCGGCTTGGGGGCTTGGGGCCGAATCTAAAACTGAGGGCCGAATCTAAAACTGAAAGAGAGAATCAAATCTAATTGAATCGCTGTAATCTAATTGAATCGCTGTGAGAAAAATCGCTGTGAGAAAGACAAGCTAGGACAAGCTAGTCTAGTGACCGACCGAAGCTAGTCTAGTGACCGACCGACCCTAGTCTAGTGACCGACCGACCGGT

Full Affymetrix probeset data:

Annotations for 1632447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720