Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632449_at:

>probe:Drosophila_2:1632449_at:574:33; Interrogation_Position=1025; Antisense; ATCAGACTTTGCCTTGTACTGCAGC
>probe:Drosophila_2:1632449_at:557:489; Interrogation_Position=1040; Antisense; GTACTGCAGCCATCGTAGATTTAAG
>probe:Drosophila_2:1632449_at:617:459; Interrogation_Position=1057; Antisense; GATTTAAGTTCCTTCACTGCGGACT
>probe:Drosophila_2:1632449_at:263:167; Interrogation_Position=1111; Antisense; AAATGTTCGTCGCAAGCGTTCTCTA
>probe:Drosophila_2:1632449_at:291:627; Interrogation_Position=637; Antisense; TCCTAAGCCTGGTTTGTTCCTTGAG
>probe:Drosophila_2:1632449_at:660:31; Interrogation_Position=670; Antisense; ATAAGGGCAGCTCCTCCAGAGTTCG
>probe:Drosophila_2:1632449_at:235:719; Interrogation_Position=691; Antisense; TTCGCTTTCTCCTGAAACTCTACAA
>probe:Drosophila_2:1632449_at:389:255; Interrogation_Position=737; Antisense; CAAACTGGCCGATTGCTACGACTGC
>probe:Drosophila_2:1632449_at:584:407; Interrogation_Position=764; Antisense; GACGGTCCTGATGATGGCTATCTTT
>probe:Drosophila_2:1632449_at:139:337; Interrogation_Position=792; Antisense; GCTGCCAATATCATCGTTTGCTTCT
>probe:Drosophila_2:1632449_at:227:481; Interrogation_Position=807; Antisense; GTTTGCTTCTATATGATCGTCTACA
>probe:Drosophila_2:1632449_at:236:453; Interrogation_Position=833; Antisense; GATCAGCCTGAGCAAGATGTCCTTT
>probe:Drosophila_2:1632449_at:43:99; Interrogation_Position=847; Antisense; AGATGTCCTTTTTCGTAATGCTAAT
>probe:Drosophila_2:1632449_at:284:15; Interrogation_Position=870; Antisense; ATTATGTTTCCCCTTGCAATAGCTA

Paste this into a BLAST search page for me
ATCAGACTTTGCCTTGTACTGCAGCGTACTGCAGCCATCGTAGATTTAAGGATTTAAGTTCCTTCACTGCGGACTAAATGTTCGTCGCAAGCGTTCTCTATCCTAAGCCTGGTTTGTTCCTTGAGATAAGGGCAGCTCCTCCAGAGTTCGTTCGCTTTCTCCTGAAACTCTACAACAAACTGGCCGATTGCTACGACTGCGACGGTCCTGATGATGGCTATCTTTGCTGCCAATATCATCGTTTGCTTCTGTTTGCTTCTATATGATCGTCTACAGATCAGCCTGAGCAAGATGTCCTTTAGATGTCCTTTTTCGTAATGCTAATATTATGTTTCCCCTTGCAATAGCTA

Full Affymetrix probeset data:

Annotations for 1632449_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime