FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632450_at:

>probe:Drosophila_2:1632450_at:150:391; Interrogation_Position=125; Antisense; GAAACATCCTCATGGAGCACCACGA
>probe:Drosophila_2:1632450_at:669:483; Interrogation_Position=186; Antisense; GTAGCATGGCTGTCGGTATTATTGT
>probe:Drosophila_2:1632450_at:134:497; Interrogation_Position=197; Antisense; GTCGGTATTATTGTCCTGATCGTTG
>probe:Drosophila_2:1632450_at:651:283; Interrogation_Position=212; Antisense; CTGATCGTTGTTATGGTGCTCCTCT
>probe:Drosophila_2:1632450_at:134:285; Interrogation_Position=272; Antisense; CTGTGCGGCTGTTGCGGACTCGCCT
>probe:Drosophila_2:1632450_at:205:329; Interrogation_Position=302; Antisense; GCGTGCCTCGCTTGCGACGAAGGAT
>probe:Drosophila_2:1632450_at:462:527; Interrogation_Position=423; Antisense; GGGACTGCACCTTGGACGATGATTA
>probe:Drosophila_2:1632450_at:262:9; Interrogation_Position=448; Antisense; ATTCGGCGATAATTCAAGTTTCTAT
>probe:Drosophila_2:1632450_at:458:483; Interrogation_Position=483; Antisense; GTAGTGCTAGGATATGCGATTCGAA
>probe:Drosophila_2:1632450_at:90:231; Interrogation_Position=521; Antisense; AATGTGCTCAGGTACAGATTCGTTA
>probe:Drosophila_2:1632450_at:444:95; Interrogation_Position=536; Antisense; AGATTCGTTAGGAGCATCCGTATGC
>probe:Drosophila_2:1632450_at:385:189; Interrogation_Position=54; Antisense; AACATTTCAATACCGTCAACAAGTG
>probe:Drosophila_2:1632450_at:495:347; Interrogation_Position=549; Antisense; GCATCCGTATGCTCATTGGCAAAAT
>probe:Drosophila_2:1632450_at:169:547; Interrogation_Position=88; Antisense; GGATGACACATTATCAACGGTAGAA

Paste this into a BLAST search page for me
GAAACATCCTCATGGAGCACCACGAGTAGCATGGCTGTCGGTATTATTGTGTCGGTATTATTGTCCTGATCGTTGCTGATCGTTGTTATGGTGCTCCTCTCTGTGCGGCTGTTGCGGACTCGCCTGCGTGCCTCGCTTGCGACGAAGGATGGGACTGCACCTTGGACGATGATTAATTCGGCGATAATTCAAGTTTCTATGTAGTGCTAGGATATGCGATTCGAAAATGTGCTCAGGTACAGATTCGTTAAGATTCGTTAGGAGCATCCGTATGCAACATTTCAATACCGTCAACAAGTGGCATCCGTATGCTCATTGGCAAAATGGATGACACATTATCAACGGTAGAA

Full Affymetrix probeset data:

Annotations for 1632450_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720