FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632451_at:

>probe:Drosophila_2:1632451_at:41:711; Interrogation_Position=1131; Antisense; TTCACGGAGGCCACCATTCGCGAAG
>probe:Drosophila_2:1632451_at:314:11; Interrogation_Position=1146; Antisense; ATTCGCGAAGGTCTGCGCATCGAGA
>probe:Drosophila_2:1632451_at:570:437; Interrogation_Position=1206; Antisense; GAGGACACCGAATTGCTGGGCTACC
>probe:Drosophila_2:1632451_at:637:671; Interrogation_Position=1227; Antisense; TACCGGATACCCAAGGACACCATTG
>probe:Drosophila_2:1632451_at:228:553; Interrogation_Position=1280; Antisense; GGACGCCCGTATTTGGTCGGATCCG
>probe:Drosophila_2:1632451_at:134:91; Interrogation_Position=1309; Antisense; AGTTCCGGCCGGAGAGATTCCTGGA
>probe:Drosophila_2:1632451_at:444:331; Interrogation_Position=1335; Antisense; GCGGATGGCAAGCTCTGCCTGAAAC
>probe:Drosophila_2:1632451_at:304:627; Interrogation_Position=1350; Antisense; TGCCTGAAACTGGATGTCTCGCTGC
>probe:Drosophila_2:1632451_at:440:597; Interrogation_Position=1398; Antisense; TGTGCCGGCGAGACATTTGCGCGCA
>probe:Drosophila_2:1632451_at:593:189; Interrogation_Position=1422; Antisense; AACATGCTCTTCCTGGTGACAGCGA
>probe:Drosophila_2:1632451_at:447:61; Interrogation_Position=1449; Antisense; ATGTGCCAGCACTTTGACTTCGTCC
>probe:Drosophila_2:1632451_at:646:603; Interrogation_Position=1522; Antisense; TGATTATTTCGCCACCAGATTTCTG
>probe:Drosophila_2:1632451_at:124:573; Interrogation_Position=1546; Antisense; GGCTGCAACTACAGGATCGGCATTG
>probe:Drosophila_2:1632451_at:103:365; Interrogation_Position=1659; Antisense; GAATTTTATTCCGTCACATTTCAAA

Paste this into a BLAST search page for me
TTCACGGAGGCCACCATTCGCGAAGATTCGCGAAGGTCTGCGCATCGAGAGAGGACACCGAATTGCTGGGCTACCTACCGGATACCCAAGGACACCATTGGGACGCCCGTATTTGGTCGGATCCGAGTTCCGGCCGGAGAGATTCCTGGAGCGGATGGCAAGCTCTGCCTGAAACTGCCTGAAACTGGATGTCTCGCTGCTGTGCCGGCGAGACATTTGCGCGCAAACATGCTCTTCCTGGTGACAGCGAATGTGCCAGCACTTTGACTTCGTCCTGATTATTTCGCCACCAGATTTCTGGGCTGCAACTACAGGATCGGCATTGGAATTTTATTCCGTCACATTTCAAA

Full Affymetrix probeset data:

Annotations for 1632451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720