FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632453_at:

>probe:Drosophila_2:1632453_at:460:93; Interrogation_Position=223; Antisense; AGTTCACTTCCTGTTTGTCCTGAAA
>probe:Drosophila_2:1632453_at:446:237; Interrogation_Position=256; Antisense; AATCAGTTGCATTGTTAGCCTGCCG
>probe:Drosophila_2:1632453_at:89:475; Interrogation_Position=269; Antisense; GTTAGCCTGCCGATGGATCACAAAT
>probe:Drosophila_2:1632453_at:459:417; Interrogation_Position=305; Antisense; GAGCGTTTGATTTGCACTTTGTACC
>probe:Drosophila_2:1632453_at:495:355; Interrogation_Position=406; Antisense; GCACGTCTTCCATCATTTTGCGATG
>probe:Drosophila_2:1632453_at:5:701; Interrogation_Position=436; Antisense; TTTTGGATATCTCTACTACTGCTTC
>probe:Drosophila_2:1632453_at:718:667; Interrogation_Position=449; Antisense; TACTACTGCTTCCACGGATACGGTG
>probe:Drosophila_2:1632453_at:274:291; Interrogation_Position=508; Antisense; CGTCCACGTGATTATGTACGCCTAC
>probe:Drosophila_2:1632453_at:41:669; Interrogation_Position=530; Antisense; TACTACTATCTATCCTCGATCAGCA
>probe:Drosophila_2:1632453_at:521:241; Interrogation_Position=585; Antisense; AATACATCACAATTGCTCAGCTGGT
>probe:Drosophila_2:1632453_at:686:119; Interrogation_Position=603; Antisense; AGCTGGTCCAGTTCGCCATTATTCT
>probe:Drosophila_2:1632453_at:338:15; Interrogation_Position=620; Antisense; ATTATTCTGCTCCACTGTACCATCA
>probe:Drosophila_2:1632453_at:330:103; Interrogation_Position=674; Antisense; AGACCCTTGACCTACGGATGCGGAT
>probe:Drosophila_2:1632453_at:110:635; Interrogation_Position=698; Antisense; TCGCTTTCAGCGTTTTTTGCAGTGA

Paste this into a BLAST search page for me
AGTTCACTTCCTGTTTGTCCTGAAAAATCAGTTGCATTGTTAGCCTGCCGGTTAGCCTGCCGATGGATCACAAATGAGCGTTTGATTTGCACTTTGTACCGCACGTCTTCCATCATTTTGCGATGTTTTGGATATCTCTACTACTGCTTCTACTACTGCTTCCACGGATACGGTGCGTCCACGTGATTATGTACGCCTACTACTACTATCTATCCTCGATCAGCAAATACATCACAATTGCTCAGCTGGTAGCTGGTCCAGTTCGCCATTATTCTATTATTCTGCTCCACTGTACCATCAAGACCCTTGACCTACGGATGCGGATTCGCTTTCAGCGTTTTTTGCAGTGA

Full Affymetrix probeset data:

Annotations for 1632453_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720