Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632455_at:

>probe:Drosophila_2:1632455_at:351:111; Interrogation_Position=102; Antisense; AGAATTGGATGTCCCCACTGGCCAG
>probe:Drosophila_2:1632455_at:107:625; Interrogation_Position=143; Antisense; TGCCGCGGCGACATCGAGAAGGTTA
>probe:Drosophila_2:1632455_at:628:369; Interrogation_Position=160; Antisense; GAAGGTTACACACACCGGACAAGTG
>probe:Drosophila_2:1632455_at:684:31; Interrogation_Position=189; Antisense; ATAAGGAGGACTACCGCAATGCCCG
>probe:Drosophila_2:1632455_at:102:235; Interrogation_Position=206; Antisense; AATGCCCGGTTCGTGAACGCCAAGC
>probe:Drosophila_2:1632455_at:518:81; Interrogation_Position=290; Antisense; ACCGAACGAGTTGTCTTCTGCGACG
>probe:Drosophila_2:1632455_at:311:327; Interrogation_Position=318; Antisense; GCGATGGTCCTTTGGGTCATCCCAA
>probe:Drosophila_2:1632455_at:535:531; Interrogation_Position=331; Antisense; GGGTCATCCCAAAGTGTACATCAAC
>probe:Drosophila_2:1632455_at:10:561; Interrogation_Position=368; Antisense; GGAAATCACATCTGCGGCTACTGCG
>probe:Drosophila_2:1632455_at:159:289; Interrogation_Position=391; Antisense; CGGCCTGCGCTTCGTCAAGAAAGAT
>probe:Drosophila_2:1632455_at:254:663; Interrogation_Position=460; Antisense; TAAAACACCTTTCTATCCTGTTGCG
>probe:Drosophila_2:1632455_at:14:47; Interrogation_Position=474; Antisense; ATCCTGTTGCGCTAGCTTGAACTAA
>probe:Drosophila_2:1632455_at:726:661; Interrogation_Position=69; Antisense; TAAACAATTTGTCCAAACTCGGCCT
>probe:Drosophila_2:1632455_at:130:641; Interrogation_Position=87; Antisense; TCGGCCTTCCGCGACAGAATTGGAT

Paste this into a BLAST search page for me
AGAATTGGATGTCCCCACTGGCCAGTGCCGCGGCGACATCGAGAAGGTTAGAAGGTTACACACACCGGACAAGTGATAAGGAGGACTACCGCAATGCCCGAATGCCCGGTTCGTGAACGCCAAGCACCGAACGAGTTGTCTTCTGCGACGGCGATGGTCCTTTGGGTCATCCCAAGGGTCATCCCAAAGTGTACATCAACGGAAATCACATCTGCGGCTACTGCGCGGCCTGCGCTTCGTCAAGAAAGATTAAAACACCTTTCTATCCTGTTGCGATCCTGTTGCGCTAGCTTGAACTAATAAACAATTTGTCCAAACTCGGCCTTCGGCCTTCCGCGACAGAATTGGAT

Full Affymetrix probeset data:

Annotations for 1632455_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime