FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632458_at:

>probe:Drosophila_2:1632458_at:715:617; Interrogation_Position=2121; Antisense; TGCAGCGGAAGATGCGCCAGCAAGA
>probe:Drosophila_2:1632458_at:359:203; Interrogation_Position=2148; Antisense; AAGCCGAGGCGCTCAAGAAGGCCAA
>probe:Drosophila_2:1632458_at:465:177; Interrogation_Position=2195; Antisense; AAACTGCAGCAGCTAACCGGCGCCA
>probe:Drosophila_2:1632458_at:2:205; Interrogation_Position=2219; Antisense; AAGCCCAAGAAGATGCTTCCGCCGC
>probe:Drosophila_2:1632458_at:292:201; Interrogation_Position=2251; Antisense; AACCAAGTACACCTGGGAGATGCTG
>probe:Drosophila_2:1632458_at:238:447; Interrogation_Position=2269; Antisense; GATGCTGCACGAAGACGACTCGACA
>probe:Drosophila_2:1632458_at:506:369; Interrogation_Position=2300; Antisense; GAGGGAAAGGTCACCCACAAGCGTC
>probe:Drosophila_2:1632458_at:108:37; Interrogation_Position=2399; Antisense; ATCATCGACAGCTTTTTCTCGGTGG
>probe:Drosophila_2:1632458_at:720:127; Interrogation_Position=2429; Antisense; ACCACACCGGACCTAAAGCAGATAT
>probe:Drosophila_2:1632458_at:435:173; Interrogation_Position=2443; Antisense; AAAGCAGATATTCCCGAACATCGAT
>probe:Drosophila_2:1632458_at:109:615; Interrogation_Position=2478; Antisense; TGAAGCGAAACTCCAGCGTGCTGTG
>probe:Drosophila_2:1632458_at:206:719; Interrogation_Position=2521; Antisense; TTCCGAGCTGCCGAAATACTAGCCA
>probe:Drosophila_2:1632458_at:610:29; Interrogation_Position=2536; Antisense; ATACTAGCCAAGTAGTCCTGCTCTC
>probe:Drosophila_2:1632458_at:397:645; Interrogation_Position=2559; Antisense; TCTTCTCCCGTAAATGCACATGTTT

Paste this into a BLAST search page for me
TGCAGCGGAAGATGCGCCAGCAAGAAAGCCGAGGCGCTCAAGAAGGCCAAAAACTGCAGCAGCTAACCGGCGCCAAAGCCCAAGAAGATGCTTCCGCCGCAACCAAGTACACCTGGGAGATGCTGGATGCTGCACGAAGACGACTCGACAGAGGGAAAGGTCACCCACAAGCGTCATCATCGACAGCTTTTTCTCGGTGGACCACACCGGACCTAAAGCAGATATAAAGCAGATATTCCCGAACATCGATTGAAGCGAAACTCCAGCGTGCTGTGTTCCGAGCTGCCGAAATACTAGCCAATACTAGCCAAGTAGTCCTGCTCTCTCTTCTCCCGTAAATGCACATGTTT

Full Affymetrix probeset data:

Annotations for 1632458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720