Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632461_at:

>probe:Drosophila_2:1632461_at:579:187; Interrogation_Position=2541; Antisense; AACACTGCCCAGCTAGAGAAGTTCG
>probe:Drosophila_2:1632461_at:619:421; Interrogation_Position=2556; Antisense; GAGAAGTTCGTGTACAGCAGCATTG
>probe:Drosophila_2:1632461_at:655:223; Interrogation_Position=2606; Antisense; AAGGATCACGGTGCTGAGTCCGGTC
>probe:Drosophila_2:1632461_at:122:273; Interrogation_Position=2702; Antisense; GCTAAATTCCGGCTTTGGTGGCGTA
>probe:Drosophila_2:1632461_at:308:533; Interrogation_Position=2718; Antisense; GGTGGCGTAAATCCTCTGTACAGCG
>probe:Drosophila_2:1632461_at:677:401; Interrogation_Position=2742; Antisense; GACATTGTGGGTATTTCCGCCTATA
>probe:Drosophila_2:1632461_at:578:81; Interrogation_Position=2818; Antisense; AGGGTTCTGAGTATGTGCCCAGCAC
>probe:Drosophila_2:1632461_at:370:625; Interrogation_Position=2833; Antisense; TGCCCAGCACTCTGCAGGATAGCGT
>probe:Drosophila_2:1632461_at:304:511; Interrogation_Position=2868; Antisense; GTGAATGCCAACTACGCGTGGCTGG
>probe:Drosophila_2:1632461_at:516:329; Interrogation_Position=2883; Antisense; GCGTGGCTGGCTTCCAACAGGGATC
>probe:Drosophila_2:1632461_at:303:81; Interrogation_Position=2901; Antisense; AGGGATCCCCTGATGACCTGGGTCG
>probe:Drosophila_2:1632461_at:647:381; Interrogation_Position=2954; Antisense; GAACGCCTCCATTTTGGCAATCCTT
>probe:Drosophila_2:1632461_at:608:715; Interrogation_Position=2986; Antisense; TTCTGGCCGCCAAGCTATTCTAAAA
>probe:Drosophila_2:1632461_at:145:477; Interrogation_Position=3027; Antisense; GTTATAGATTTCCATTGTGCGCCCA

Paste this into a BLAST search page for me
AACACTGCCCAGCTAGAGAAGTTCGGAGAAGTTCGTGTACAGCAGCATTGAAGGATCACGGTGCTGAGTCCGGTCGCTAAATTCCGGCTTTGGTGGCGTAGGTGGCGTAAATCCTCTGTACAGCGGACATTGTGGGTATTTCCGCCTATAAGGGTTCTGAGTATGTGCCCAGCACTGCCCAGCACTCTGCAGGATAGCGTGTGAATGCCAACTACGCGTGGCTGGGCGTGGCTGGCTTCCAACAGGGATCAGGGATCCCCTGATGACCTGGGTCGGAACGCCTCCATTTTGGCAATCCTTTTCTGGCCGCCAAGCTATTCTAAAAGTTATAGATTTCCATTGTGCGCCCA

Full Affymetrix probeset data:

Annotations for 1632461_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime