FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632462_at:

>probe:Drosophila_2:1632462_at:313:523; Interrogation_Position=594; Antisense; GGGCGAACATTAGCCAGGACCAGTT
>probe:Drosophila_2:1632462_at:677:413; Interrogation_Position=611; Antisense; GACCAGTTGGTCAGCATTGCGGAGA
>probe:Drosophila_2:1632462_at:105:39; Interrogation_Position=674; Antisense; ATCTCGTTCGAGGACTTCTGCAAAG
>probe:Drosophila_2:1632462_at:283:75; Interrogation_Position=684; Antisense; AGGACTTCTGCAAAGCTCTGGACCG
>probe:Drosophila_2:1632462_at:458:587; Interrogation_Position=702; Antisense; TGGACCGCACCGACGTGGATCAGAA
>probe:Drosophila_2:1632462_at:172:375; Interrogation_Position=724; Antisense; GAAGATGTCCATACGGTTTCTCAAC
>probe:Drosophila_2:1632462_at:252:671; Interrogation_Position=735; Antisense; TACGGTTTCTCAACTAGGCTAGCTG
>probe:Drosophila_2:1632462_at:23:681; Interrogation_Position=749; Antisense; TAGGCTAGCTGGATGCGGCAATCAC
>probe:Drosophila_2:1632462_at:504:417; Interrogation_Position=781; Antisense; GAGCGACCTTCTTAGTCAGTGTGTA
>probe:Drosophila_2:1632462_at:678:349; Interrogation_Position=822; Antisense; GCAGTTAGTCGAGAGGCATTCCGGC
>probe:Drosophila_2:1632462_at:569:341; Interrogation_Position=837; Antisense; GCATTCCGGCGGGTTACTGAAAACT
>probe:Drosophila_2:1632462_at:620:349; Interrogation_Position=876; Antisense; GCAGTGGTTGCTATTCTTATTATAC
>probe:Drosophila_2:1632462_at:171:25; Interrogation_Position=897; Antisense; ATACCAGTTGTGTTTTCCAACCATT
>probe:Drosophila_2:1632462_at:729:175; Interrogation_Position=971; Antisense; AAACCTGAGTAATTTGCCCAAAGCT

Paste this into a BLAST search page for me
GGGCGAACATTAGCCAGGACCAGTTGACCAGTTGGTCAGCATTGCGGAGAATCTCGTTCGAGGACTTCTGCAAAGAGGACTTCTGCAAAGCTCTGGACCGTGGACCGCACCGACGTGGATCAGAAGAAGATGTCCATACGGTTTCTCAACTACGGTTTCTCAACTAGGCTAGCTGTAGGCTAGCTGGATGCGGCAATCACGAGCGACCTTCTTAGTCAGTGTGTAGCAGTTAGTCGAGAGGCATTCCGGCGCATTCCGGCGGGTTACTGAAAACTGCAGTGGTTGCTATTCTTATTATACATACCAGTTGTGTTTTCCAACCATTAAACCTGAGTAATTTGCCCAAAGCT

Full Affymetrix probeset data:

Annotations for 1632462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720