FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632464_at:

>probe:Drosophila_2:1632464_at:427:359; Interrogation_Position=2777; Antisense; GCAATGGCTGTCTCGAAAACGGCAA
>probe:Drosophila_2:1632464_at:673:3; Interrogation_Position=2845; Antisense; ATTGGTGCTCATTACAACCGATCGT
>probe:Drosophila_2:1632464_at:236:201; Interrogation_Position=2860; Antisense; AACCGATCGTAATCTGCGTGTGAAG
>probe:Drosophila_2:1632464_at:154:613; Interrogation_Position=2880; Antisense; TGAAGGCTCTTTCTCGCAATTTGGC
>probe:Drosophila_2:1632464_at:220:243; Interrogation_Position=2897; Antisense; AATTTGGCCGTCAGCGCGTTGGATG
>probe:Drosophila_2:1632464_at:85:79; Interrogation_Position=2940; Antisense; AGGATTGCCGCGAATCAACCTGAAA
>probe:Drosophila_2:1632464_at:565:3; Interrogation_Position=2997; Antisense; ATTGGAATGGACTTGCACGACGCAC
>probe:Drosophila_2:1632464_at:302:99; Interrogation_Position=3098; Antisense; AGATGCGGACACATACGCTGGCTGC
>probe:Drosophila_2:1632464_at:124:331; Interrogation_Position=3114; Antisense; GCTGGCTGCGGATACGTACACGACG
>probe:Drosophila_2:1632464_at:367:659; Interrogation_Position=3130; Antisense; TACACGACGTGGATTTCTGAGGACT
>probe:Drosophila_2:1632464_at:494:639; Interrogation_Position=3145; Antisense; TCTGAGGACTGGTCGCGGGTACACA
>probe:Drosophila_2:1632464_at:606:665; Interrogation_Position=3164; Antisense; TACACATGCGCGGTTGCTGTGGTGT
>probe:Drosophila_2:1632464_at:344:1; Interrogation_Position=3190; Antisense; TCCCCGGGTTGATGCTTTAACGAAG
>probe:Drosophila_2:1632464_at:635:209; Interrogation_Position=3212; Antisense; AAGCACATCTCTCGTTGGTTTCCAA

Paste this into a BLAST search page for me
GCAATGGCTGTCTCGAAAACGGCAAATTGGTGCTCATTACAACCGATCGTAACCGATCGTAATCTGCGTGTGAAGTGAAGGCTCTTTCTCGCAATTTGGCAATTTGGCCGTCAGCGCGTTGGATGAGGATTGCCGCGAATCAACCTGAAAATTGGAATGGACTTGCACGACGCACAGATGCGGACACATACGCTGGCTGCGCTGGCTGCGGATACGTACACGACGTACACGACGTGGATTTCTGAGGACTTCTGAGGACTGGTCGCGGGTACACATACACATGCGCGGTTGCTGTGGTGTTCCCCGGGTTGATGCTTTAACGAAGAAGCACATCTCTCGTTGGTTTCCAA

Full Affymetrix probeset data:

Annotations for 1632464_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720