FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632470_at:

>probe:Drosophila_2:1632470_at:539:395; Interrogation_Position=2807; Antisense; GACAAGCGGCGCTCGGACAAGAAGT
>probe:Drosophila_2:1632470_at:98:419; Interrogation_Position=2872; Antisense; GAGCAGTCGCAAGCGCGGTCACAAG
>probe:Drosophila_2:1632470_at:609:71; Interrogation_Position=2913; Antisense; AGGCTGGCGACAACAGCGATTCCGA
>probe:Drosophila_2:1632470_at:336:437; Interrogation_Position=2936; Antisense; GAGGACGAGCATGTGCCCAAGAAAA
>probe:Drosophila_2:1632470_at:227:109; Interrogation_Position=2976; Antisense; AGAAGCCGGCGGATTCCAGTGACAG
>probe:Drosophila_2:1632470_at:225:629; Interrogation_Position=2990; Antisense; TCCAGTGACAGCGACTCAGAGGCCT
>probe:Drosophila_2:1632470_at:35:101; Interrogation_Position=3007; Antisense; AGAGGCCTCCTCCAAGCGCAAGAAG
>probe:Drosophila_2:1632470_at:546:159; Interrogation_Position=3081; Antisense; ACAAGCGGAAGTGCAGTGCCGGCAA
>probe:Drosophila_2:1632470_at:142:331; Interrogation_Position=3113; Antisense; GCGGACAGCAGTTCCCAGGGCAGCA
>probe:Drosophila_2:1632470_at:426:77; Interrogation_Position=3144; Antisense; AGGATGAGCAGTTGCCGCACTCGGT
>probe:Drosophila_2:1632470_at:280:391; Interrogation_Position=3186; Antisense; GAAACGCTGGCAAGCTGGCGCTACT
>probe:Drosophila_2:1632470_at:661:415; Interrogation_Position=3228; Antisense; GAGCCGGTGTCATCAACGAGGACCT
>probe:Drosophila_2:1632470_at:485:129; Interrogation_Position=3249; Antisense; ACCTCGAGAAGCAGCTGCGGGAACG
>probe:Drosophila_2:1632470_at:292:525; Interrogation_Position=3267; Antisense; GGGAACGGGCCCTCAAATCGATGAA

Paste this into a BLAST search page for me
GACAAGCGGCGCTCGGACAAGAAGTGAGCAGTCGCAAGCGCGGTCACAAGAGGCTGGCGACAACAGCGATTCCGAGAGGACGAGCATGTGCCCAAGAAAAAGAAGCCGGCGGATTCCAGTGACAGTCCAGTGACAGCGACTCAGAGGCCTAGAGGCCTCCTCCAAGCGCAAGAAGACAAGCGGAAGTGCAGTGCCGGCAAGCGGACAGCAGTTCCCAGGGCAGCAAGGATGAGCAGTTGCCGCACTCGGTGAAACGCTGGCAAGCTGGCGCTACTGAGCCGGTGTCATCAACGAGGACCTACCTCGAGAAGCAGCTGCGGGAACGGGGAACGGGCCCTCAAATCGATGAA

Full Affymetrix probeset data:

Annotations for 1632470_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720