FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632471_at:

>probe:Drosophila_2:1632471_at:199:677; Interrogation_Position=2110; Antisense; TAGGGACACCTGTTTTTAGTTATGT
>probe:Drosophila_2:1632471_at:314:181; Interrogation_Position=2142; Antisense; AAAACAACCAATACGATCCCTGAGT
>probe:Drosophila_2:1632471_at:293:137; Interrogation_Position=2154; Antisense; ACGATCCCTGAGTAGTTGCCTAGTT
>probe:Drosophila_2:1632471_at:416:93; Interrogation_Position=2167; Antisense; AGTTGCCTAGTTTTTTCCATGTATA
>probe:Drosophila_2:1632471_at:630:453; Interrogation_Position=2193; Antisense; GATTAGGATGCGTACCGTTTACCAG
>probe:Drosophila_2:1632471_at:695:325; Interrogation_Position=2202; Antisense; GCGTACCGTTTACCAGTTTGCAAGT
>probe:Drosophila_2:1632471_at:193:481; Interrogation_Position=2217; Antisense; GTTTGCAAGTTCGTGGATTCCGCGT
>probe:Drosophila_2:1632471_at:583:7; Interrogation_Position=2233; Antisense; ATTCCGCGTTCTTCAATTAGCTTTA
>probe:Drosophila_2:1632471_at:432:711; Interrogation_Position=2244; Antisense; TTCAATTAGCTTTATCCTCCACCCA
>probe:Drosophila_2:1632471_at:139:299; Interrogation_Position=2298; Antisense; CCTCTACACCATCCATTCGAGTAAA
>probe:Drosophila_2:1632471_at:84:15; Interrogation_Position=2340; Antisense; ATTAGCCAGCGTTACAATCAATTGT
>probe:Drosophila_2:1632471_at:374:235; Interrogation_Position=2386; Antisense; AATCGATTCTCGAAAACTACACAAT
>probe:Drosophila_2:1632471_at:264:27; Interrogation_Position=2430; Antisense; ATAGCTTGTTTGCAACAGATGATCT
>probe:Drosophila_2:1632471_at:447:265; Interrogation_Position=2445; Antisense; CAGATGATCTATACCTAAGTCTTAG

Paste this into a BLAST search page for me
TAGGGACACCTGTTTTTAGTTATGTAAAACAACCAATACGATCCCTGAGTACGATCCCTGAGTAGTTGCCTAGTTAGTTGCCTAGTTTTTTCCATGTATAGATTAGGATGCGTACCGTTTACCAGGCGTACCGTTTACCAGTTTGCAAGTGTTTGCAAGTTCGTGGATTCCGCGTATTCCGCGTTCTTCAATTAGCTTTATTCAATTAGCTTTATCCTCCACCCACCTCTACACCATCCATTCGAGTAAAATTAGCCAGCGTTACAATCAATTGTAATCGATTCTCGAAAACTACACAATATAGCTTGTTTGCAACAGATGATCTCAGATGATCTATACCTAAGTCTTAG

Full Affymetrix probeset data:

Annotations for 1632471_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720