FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632474_at:

>probe:Drosophila_2:1632474_at:46:43; Interrogation_Position=1022; Antisense; ATCGGTATCTTCTAGTTGCTTGGGC
>probe:Drosophila_2:1632474_at:92:617; Interrogation_Position=511; Antisense; TGCAGCGCATCGTTGGCCACAAGGA
>probe:Drosophila_2:1632474_at:511:551; Interrogation_Position=554; Antisense; GGAGAACGATATCGCACTGCTCTTT
>probe:Drosophila_2:1632474_at:102:145; Interrogation_Position=569; Antisense; ACTGCTCTTTCTCAACGGATTCATA
>probe:Drosophila_2:1632474_at:292:647; Interrogation_Position=589; Antisense; TCATACCGTGGGAATCGCCGGGTGT
>probe:Drosophila_2:1632474_at:78:553; Interrogation_Position=695; Antisense; GGAGAAATCGGCTTCGCTGCAGCAA
>probe:Drosophila_2:1632474_at:22:77; Interrogation_Position=742; Antisense; AGGAGCTCTGCCAGGTGATCTACAA
>probe:Drosophila_2:1632474_at:59:305; Interrogation_Position=790; Antisense; CCGGATTTTTGCAGGGCGGCATCGA
>probe:Drosophila_2:1632474_at:634:331; Interrogation_Position=842; Antisense; GCTGATCTGCGATGGACGTCTGGCC
>probe:Drosophila_2:1632474_at:675:559; Interrogation_Position=903; Antisense; GGCTATCCGGGTGTCTATACCAATG
>probe:Drosophila_2:1632474_at:614:229; Interrogation_Position=924; Antisense; AATGTATCGCACTTTCTCAAATGGA
>probe:Drosophila_2:1632474_at:81:223; Interrogation_Position=953; Antisense; AAGGGCTAACGCTTCGCTGGACTAC
>probe:Drosophila_2:1632474_at:650:555; Interrogation_Position=971; Antisense; GGACTACTCCGAGTACCGGCAAATA
>probe:Drosophila_2:1632474_at:26:165; Interrogation_Position=991; Antisense; AAATACCGCCGCTAAATCTGGCTAG

Paste this into a BLAST search page for me
ATCGGTATCTTCTAGTTGCTTGGGCTGCAGCGCATCGTTGGCCACAAGGAGGAGAACGATATCGCACTGCTCTTTACTGCTCTTTCTCAACGGATTCATATCATACCGTGGGAATCGCCGGGTGTGGAGAAATCGGCTTCGCTGCAGCAAAGGAGCTCTGCCAGGTGATCTACAACCGGATTTTTGCAGGGCGGCATCGAGCTGATCTGCGATGGACGTCTGGCCGGCTATCCGGGTGTCTATACCAATGAATGTATCGCACTTTCTCAAATGGAAAGGGCTAACGCTTCGCTGGACTACGGACTACTCCGAGTACCGGCAAATAAAATACCGCCGCTAAATCTGGCTAG

Full Affymetrix probeset data:

Annotations for 1632474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720