Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632475_at:

>probe:Drosophila_2:1632475_at:574:427; Interrogation_Position=4973; Antisense; GAGATATCCTAAACAAACACACCAA
>probe:Drosophila_2:1632475_at:464:189; Interrogation_Position=5024; Antisense; AACATACCAACAACCCGAGGTCATG
>probe:Drosophila_2:1632475_at:607:301; Interrogation_Position=5037; Antisense; CCCGAGGTCATGAACTTGTGCTTAT
>probe:Drosophila_2:1632475_at:41:681; Interrogation_Position=5059; Antisense; TATGAAATTCACCACGACAACGTTT
>probe:Drosophila_2:1632475_at:357:293; Interrogation_Position=5110; Antisense; CGATCAACGCGAGTCTATATATATA
>probe:Drosophila_2:1632475_at:445:385; Interrogation_Position=5197; Antisense; GAACATTTCAAGCTCACTCGTCGAG
>probe:Drosophila_2:1632475_at:583:145; Interrogation_Position=5212; Antisense; ACTCGTCGAGGTTTTTTGTCAGATC
>probe:Drosophila_2:1632475_at:662:709; Interrogation_Position=5258; Antisense; TTAAAGCAATTCGTATCCTCCATCC
>probe:Drosophila_2:1632475_at:541:47; Interrogation_Position=5272; Antisense; ATCCTCCATCCTTTCGATGTATGTA
>probe:Drosophila_2:1632475_at:457:475; Interrogation_Position=5304; Antisense; GTTACATAACTGAACACACACCCAG
>probe:Drosophila_2:1632475_at:381:711; Interrogation_Position=5350; Antisense; TTCATTTCAAATGTCGTTTCACGAT
>probe:Drosophila_2:1632475_at:296:139; Interrogation_Position=5370; Antisense; ACGATTGTGTATGATTTCGCTTACA
>probe:Drosophila_2:1632475_at:282:91; Interrogation_Position=5413; Antisense; AGTTAGCAACGCAGCATAAGCCCAC
>probe:Drosophila_2:1632475_at:183:483; Interrogation_Position=5449; Antisense; GTATATCGAATTTTCTGCGCACAGC

Paste this into a BLAST search page for me
GAGATATCCTAAACAAACACACCAAAACATACCAACAACCCGAGGTCATGCCCGAGGTCATGAACTTGTGCTTATTATGAAATTCACCACGACAACGTTTCGATCAACGCGAGTCTATATATATAGAACATTTCAAGCTCACTCGTCGAGACTCGTCGAGGTTTTTTGTCAGATCTTAAAGCAATTCGTATCCTCCATCCATCCTCCATCCTTTCGATGTATGTAGTTACATAACTGAACACACACCCAGTTCATTTCAAATGTCGTTTCACGATACGATTGTGTATGATTTCGCTTACAAGTTAGCAACGCAGCATAAGCCCACGTATATCGAATTTTCTGCGCACAGC

Full Affymetrix probeset data:

Annotations for 1632475_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime