FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632479_at:

>probe:Drosophila_2:1632479_at:399:343; Interrogation_Position=130; Antisense; GCTTCATCATCACGTTCTTCGGAAT
>probe:Drosophila_2:1632479_at:718:343; Interrogation_Position=151; Antisense; GAATTGTGGGCCTCGTCTACGGAGC
>probe:Drosophila_2:1632479_at:318:671; Interrogation_Position=168; Antisense; TACGGAGCCTTCGTGCAGCAGTTCT
>probe:Drosophila_2:1632479_at:409:115; Interrogation_Position=184; Antisense; AGCAGTTCTCACAGACCGTGTACAT
>probe:Drosophila_2:1632479_at:6:291; Interrogation_Position=200; Antisense; CGTGTACATCCTGGGCGCCGGATTT
>probe:Drosophila_2:1632479_at:629:543; Interrogation_Position=219; Antisense; GGATTTGTGCTCTCCTCGCTGATCA
>probe:Drosophila_2:1632479_at:93:487; Interrogation_Position=263; Antisense; GTACCGTCGCAATGCGCTCAAATGG
>probe:Drosophila_2:1632479_at:432:389; Interrogation_Position=290; Antisense; GAAACCCATCGATACGGACGCCAAG
>probe:Drosophila_2:1632479_at:320:217; Interrogation_Position=312; Antisense; AAGTCGTCGAGCTCCGAGTCCGGCG
>probe:Drosophila_2:1632479_at:462:5; Interrogation_Position=37; Antisense; ATTGTTGAATCGCAGCTTGTGAATT
>probe:Drosophila_2:1632479_at:49:455; Interrogation_Position=375; Antisense; GATCAGTAGTTAGTTAGGCCAGCAG
>probe:Drosophila_2:1632479_at:378:69; Interrogation_Position=390; Antisense; AGGCCAGCAGTTACGTGTACTTCTC
>probe:Drosophila_2:1632479_at:572:515; Interrogation_Position=404; Antisense; GTGTACTTCTCACTACATCCAATAT
>probe:Drosophila_2:1632479_at:578:103; Interrogation_Position=82; Antisense; AGACGCATATGGACTTCGCGGGTCA

Paste this into a BLAST search page for me
GCTTCATCATCACGTTCTTCGGAATGAATTGTGGGCCTCGTCTACGGAGCTACGGAGCCTTCGTGCAGCAGTTCTAGCAGTTCTCACAGACCGTGTACATCGTGTACATCCTGGGCGCCGGATTTGGATTTGTGCTCTCCTCGCTGATCAGTACCGTCGCAATGCGCTCAAATGGGAAACCCATCGATACGGACGCCAAGAAGTCGTCGAGCTCCGAGTCCGGCGATTGTTGAATCGCAGCTTGTGAATTGATCAGTAGTTAGTTAGGCCAGCAGAGGCCAGCAGTTACGTGTACTTCTCGTGTACTTCTCACTACATCCAATATAGACGCATATGGACTTCGCGGGTCA

Full Affymetrix probeset data:

Annotations for 1632479_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720