Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632481_at:

>probe:Drosophila_2:1632481_at:491:141; Interrogation_Position=2002; Antisense; ACGGCGCCCGCAGATCGGATTATTA
>probe:Drosophila_2:1632481_at:361:31; Interrogation_Position=2046; Antisense; ATAAAAGTTACTCTCTGCGGGCAAT
>probe:Drosophila_2:1632481_at:141:681; Interrogation_Position=2076; Antisense; TTGGTCCGTTCCACGATGTGATGAT
>probe:Drosophila_2:1632481_at:311:607; Interrogation_Position=2100; Antisense; TGATGTGTGATGTGCGTCTCGAGTC
>probe:Drosophila_2:1632481_at:80:145; Interrogation_Position=2143; Antisense; ACTGCAATTGTTTGTCATCCGACGA
>probe:Drosophila_2:1632481_at:685:529; Interrogation_Position=2170; Antisense; GGGATATACAATACGCCCTGATCAG
>probe:Drosophila_2:1632481_at:690:455; Interrogation_Position=2210; Antisense; GATATGCGATTCGAGCCCGATCAGG
>probe:Drosophila_2:1632481_at:690:267; Interrogation_Position=2231; Antisense; CAGGCCGGTTTATATGCTATTTTAC
>probe:Drosophila_2:1632481_at:353:217; Interrogation_Position=2292; Antisense; AAGTTACCGCATGTTTTTGTGTCAA
>probe:Drosophila_2:1632481_at:373:105; Interrogation_Position=2389; Antisense; AGACTTGTGCGCCTAGAGCAACGAA
>probe:Drosophila_2:1632481_at:660:685; Interrogation_Position=2448; Antisense; TATCTCATTCATACAACTTGGTCGT
>probe:Drosophila_2:1632481_at:356:537; Interrogation_Position=2467; Antisense; GGTCGTTTGTTACTAGCATTCGCAC
>probe:Drosophila_2:1632481_at:186:427; Interrogation_Position=2492; Antisense; GAGTTCGAAACTGTGTCCTGGTTAA
>probe:Drosophila_2:1632481_at:107:479; Interrogation_Position=2552; Antisense; GTTTATACACATGCCTTTCTTCAAA

Paste this into a BLAST search page for me
ACGGCGCCCGCAGATCGGATTATTAATAAAAGTTACTCTCTGCGGGCAATTTGGTCCGTTCCACGATGTGATGATTGATGTGTGATGTGCGTCTCGAGTCACTGCAATTGTTTGTCATCCGACGAGGGATATACAATACGCCCTGATCAGGATATGCGATTCGAGCCCGATCAGGCAGGCCGGTTTATATGCTATTTTACAAGTTACCGCATGTTTTTGTGTCAAAGACTTGTGCGCCTAGAGCAACGAATATCTCATTCATACAACTTGGTCGTGGTCGTTTGTTACTAGCATTCGCACGAGTTCGAAACTGTGTCCTGGTTAAGTTTATACACATGCCTTTCTTCAAA

Full Affymetrix probeset data:

Annotations for 1632481_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime