Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632482_at:

>probe:Drosophila_2:1632482_at:685:575; Interrogation_Position=1114; Antisense; GGCGATCTGGCCACTAAAGAGAAGG
>probe:Drosophila_2:1632482_at:43:213; Interrogation_Position=1163; Antisense; AAGAGAAGCCGGAGCCCAAGCAGGC
>probe:Drosophila_2:1632482_at:352:205; Interrogation_Position=1225; Antisense; AAGCGCAAGCCTCGCAAAGGCGATT
>probe:Drosophila_2:1632482_at:206:545; Interrogation_Position=1270; Antisense; GGATCTTCAGCCTTAGCGATCATCA
>probe:Drosophila_2:1632482_at:374:675; Interrogation_Position=1283; Antisense; TAGCGATCATCAGAAGCGGCAACAA
>probe:Drosophila_2:1632482_at:137:427; Interrogation_Position=1328; Antisense; GAGAGGAACACAACCTCTTACCCAA
>probe:Drosophila_2:1632482_at:589:271; Interrogation_Position=1344; Antisense; CTTACCCAAGCATCATTCGAGCGGA
>probe:Drosophila_2:1632482_at:370:417; Interrogation_Position=1362; Antisense; GAGCGGACATAATCCGTCTGCTCTG
>probe:Drosophila_2:1632482_at:428:625; Interrogation_Position=1385; Antisense; TGCCTTCGCGCACAAAACCGATTGT
>probe:Drosophila_2:1632482_at:726:281; Interrogation_Position=1415; Antisense; CTCCTTCTAATCCTAGCCAGAAAAC
>probe:Drosophila_2:1632482_at:263:287; Interrogation_Position=1439; Antisense; CGGCGCCCCATGTATTTCATAATTA
>probe:Drosophila_2:1632482_at:498:47; Interrogation_Position=1481; Antisense; ATCCATTAAGCGATAGCAAGCGTAA
>probe:Drosophila_2:1632482_at:157:691; Interrogation_Position=1564; Antisense; TTTGTGTTCAACTTGGTTTCCACAC
>probe:Drosophila_2:1632482_at:679:539; Interrogation_Position=1578; Antisense; GGTTTCCACACAATTCATTTCTCTT

Paste this into a BLAST search page for me
GGCGATCTGGCCACTAAAGAGAAGGAAGAGAAGCCGGAGCCCAAGCAGGCAAGCGCAAGCCTCGCAAAGGCGATTGGATCTTCAGCCTTAGCGATCATCATAGCGATCATCAGAAGCGGCAACAAGAGAGGAACACAACCTCTTACCCAACTTACCCAAGCATCATTCGAGCGGAGAGCGGACATAATCCGTCTGCTCTGTGCCTTCGCGCACAAAACCGATTGTCTCCTTCTAATCCTAGCCAGAAAACCGGCGCCCCATGTATTTCATAATTAATCCATTAAGCGATAGCAAGCGTAATTTGTGTTCAACTTGGTTTCCACACGGTTTCCACACAATTCATTTCTCTT

Full Affymetrix probeset data:

Annotations for 1632482_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime