FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632483_at:

>probe:Drosophila_2:1632483_at:300:215; Interrogation_Position=354; Antisense; AAGATCATGCCCGTCCAGAAGCAGA
>probe:Drosophila_2:1632483_at:110:209; Interrogation_Position=372; Antisense; AAGCAGACCCGTGCTGGTCAGCGTA
>probe:Drosophila_2:1632483_at:670:477; Interrogation_Position=400; Antisense; GTTTCAAGGCCTTCGTTGCCATCGG
>probe:Drosophila_2:1632483_at:495:39; Interrogation_Position=420; Antisense; ATCGGCGACAACAATGGCCACATTG
>probe:Drosophila_2:1632483_at:527:3; Interrogation_Position=441; Antisense; ATTGGTCTGGGCGTTAAGTGCAGCA
>probe:Drosophila_2:1632483_at:427:349; Interrogation_Position=460; Antisense; GCAGCAAGGAAGTGGCCACCGCCAT
>probe:Drosophila_2:1632483_at:113:519; Interrogation_Position=487; Antisense; GTGGTGCCATCATTCTGGCCAAGCT
>probe:Drosophila_2:1632483_at:346:119; Interrogation_Position=667; Antisense; AGCTGCTGACCATGGCCGGTATTGA
>probe:Drosophila_2:1632483_at:133:691; Interrogation_Position=686; Antisense; TATTGAGGATTGCTACACCTCGGCC
>probe:Drosophila_2:1632483_at:608:563; Interrogation_Position=732; Antisense; GGCAACTTCGCCAAGGCTACATATG
>probe:Drosophila_2:1632483_at:450:371; Interrogation_Position=800; Antisense; GAAGGAGATGCCTCTGGGCTCCACT
>probe:Drosophila_2:1632483_at:474:499; Interrogation_Position=868; Antisense; GTCTGCACGCCGATGCCTAAGTGAA
>probe:Drosophila_2:1632483_at:49:657; Interrogation_Position=885; Antisense; TAAGTGAACACTTTCGAGGCCAATC
>probe:Drosophila_2:1632483_at:29:293; Interrogation_Position=899; Antisense; CGAGGCCAATCAATCCAGAGTTTTT

Paste this into a BLAST search page for me
AAGATCATGCCCGTCCAGAAGCAGAAAGCAGACCCGTGCTGGTCAGCGTAGTTTCAAGGCCTTCGTTGCCATCGGATCGGCGACAACAATGGCCACATTGATTGGTCTGGGCGTTAAGTGCAGCAGCAGCAAGGAAGTGGCCACCGCCATGTGGTGCCATCATTCTGGCCAAGCTAGCTGCTGACCATGGCCGGTATTGATATTGAGGATTGCTACACCTCGGCCGGCAACTTCGCCAAGGCTACATATGGAAGGAGATGCCTCTGGGCTCCACTGTCTGCACGCCGATGCCTAAGTGAATAAGTGAACACTTTCGAGGCCAATCCGAGGCCAATCAATCCAGAGTTTTT

Full Affymetrix probeset data:

Annotations for 1632483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720