FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632484_at:

>probe:Drosophila_2:1632484_at:293:269; Interrogation_Position=1976; Antisense; CATCCGGTTCAGTTTGTAAGCCAGT
>probe:Drosophila_2:1632484_at:384:493; Interrogation_Position=1991; Antisense; GTAAGCCAGTCAATCGCTTTAGCCC
>probe:Drosophila_2:1632484_at:552:269; Interrogation_Position=2016; Antisense; CTAGGCCTCGTCTACGTTAGTTTAT
>probe:Drosophila_2:1632484_at:355:35; Interrogation_Position=2047; Antisense; ATCAGAGTCGGTCTGGTCGCAGAAT
>probe:Drosophila_2:1632484_at:8:205; Interrogation_Position=2087; Antisense; AAGCCAAATGTGTACACGCGCGAGT
>probe:Drosophila_2:1632484_at:643:633; Interrogation_Position=2115; Antisense; TCCCGATTCGGCAGTATGTATCAGT
>probe:Drosophila_2:1632484_at:73:265; Interrogation_Position=2136; Antisense; CAGTATCAGGTCACGTTTAGTCATA
>probe:Drosophila_2:1632484_at:13:677; Interrogation_Position=2183; Antisense; TAGCAATAGAGAGTGCGCGCCTAGT
>probe:Drosophila_2:1632484_at:398:323; Interrogation_Position=2197; Antisense; GCGCGCCTAGTTTTTGTAGACACTT
>probe:Drosophila_2:1632484_at:316:399; Interrogation_Position=2215; Antisense; GACACTTTATATACAGTCCCCGAAA
>probe:Drosophila_2:1632484_at:705:399; Interrogation_Position=2240; Antisense; GACAGGATCGTTCAGCGCGAGTTTA
>probe:Drosophila_2:1632484_at:435:485; Interrogation_Position=2334; Antisense; GTAGTAGCGATATATTCCACAGTTT
>probe:Drosophila_2:1632484_at:34:629; Interrogation_Position=2349; Antisense; TCCACAGTTTGGCATTCATTGCGTT
>probe:Drosophila_2:1632484_at:477:5; Interrogation_Position=2457; Antisense; ATTGCTTTATTTGTACCGGTTATTG

Paste this into a BLAST search page for me
CATCCGGTTCAGTTTGTAAGCCAGTGTAAGCCAGTCAATCGCTTTAGCCCCTAGGCCTCGTCTACGTTAGTTTATATCAGAGTCGGTCTGGTCGCAGAATAAGCCAAATGTGTACACGCGCGAGTTCCCGATTCGGCAGTATGTATCAGTCAGTATCAGGTCACGTTTAGTCATATAGCAATAGAGAGTGCGCGCCTAGTGCGCGCCTAGTTTTTGTAGACACTTGACACTTTATATACAGTCCCCGAAAGACAGGATCGTTCAGCGCGAGTTTAGTAGTAGCGATATATTCCACAGTTTTCCACAGTTTGGCATTCATTGCGTTATTGCTTTATTTGTACCGGTTATTG

Full Affymetrix probeset data:

Annotations for 1632484_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720