FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632487_at:

>probe:Drosophila_2:1632487_at:277:425; Interrogation_Position=1020; Antisense; GAGACGGACGCCAACCTGATCTGGT
>probe:Drosophila_2:1632487_at:723:449; Interrogation_Position=1037; Antisense; GATCTGGTCTATGGGTGCCTACGAA
>probe:Drosophila_2:1632487_at:433:223; Interrogation_Position=1071; Antisense; AAGGTGCGACAAGCCGCCAAGACAT
>probe:Drosophila_2:1632487_at:599:393; Interrogation_Position=1126; Antisense; GAAAGGCTTAGATTACACCAGTGTA
>probe:Drosophila_2:1632487_at:645:467; Interrogation_Position=1155; Antisense; GTTGACCACAGCTGCATCTGATTGT
>probe:Drosophila_2:1632487_at:643:591; Interrogation_Position=700; Antisense; TGGTGTTTCATGACACTTCCGGTCG
>probe:Drosophila_2:1632487_at:460:647; Interrogation_Position=736; Antisense; TCATGGCCAACCTAAACACGCTGTA
>probe:Drosophila_2:1632487_at:180:195; Interrogation_Position=777; Antisense; AACTGCAATGTCTTCCTGTTGAGCG
>probe:Drosophila_2:1632487_at:499:1; Interrogation_Position=805; Antisense; ATTCGGTGACGTGGTTATTGCGGCC
>probe:Drosophila_2:1632487_at:478:689; Interrogation_Position=820; Antisense; TATTGCGGCCGGGAAAGCACACGAT
>probe:Drosophila_2:1632487_at:430:65; Interrogation_Position=878; Antisense; ATGGTGCTCTCTGATGCCCGTGGGA
>probe:Drosophila_2:1632487_at:335:231; Interrogation_Position=915; Antisense; AATGTCACTACCACGGGACTCAAAT
>probe:Drosophila_2:1632487_at:693:561; Interrogation_Position=940; Antisense; GGAACCTATATCATGCACAGCTGGA
>probe:Drosophila_2:1632487_at:636:179; Interrogation_Position=989; Antisense; AAACACCTATGCGACCGAGTTCGTC

Paste this into a BLAST search page for me
GAGACGGACGCCAACCTGATCTGGTGATCTGGTCTATGGGTGCCTACGAAAAGGTGCGACAAGCCGCCAAGACATGAAAGGCTTAGATTACACCAGTGTAGTTGACCACAGCTGCATCTGATTGTTGGTGTTTCATGACACTTCCGGTCGTCATGGCCAACCTAAACACGCTGTAAACTGCAATGTCTTCCTGTTGAGCGATTCGGTGACGTGGTTATTGCGGCCTATTGCGGCCGGGAAAGCACACGATATGGTGCTCTCTGATGCCCGTGGGAAATGTCACTACCACGGGACTCAAATGGAACCTATATCATGCACAGCTGGAAAACACCTATGCGACCGAGTTCGTC

Full Affymetrix probeset data:

Annotations for 1632487_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720