Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632489_a_at:

>probe:Drosophila_2:1632489_a_at:301:661; Interrogation_Position=363; Antisense; TAAAACTGCTAACCGGCCTCTTTGT
>probe:Drosophila_2:1632489_a_at:23:623; Interrogation_Position=387; Antisense; TGCGCACTGATCACCCGGAAATAGT
>probe:Drosophila_2:1632489_a_at:376:395; Interrogation_Position=404; Antisense; GAAATAGTACTTCACAGCCTGGCGC
>probe:Drosophila_2:1632489_a_at:663:125; Interrogation_Position=419; Antisense; AGCCTGGCGCTCTTTTACCAATTAC
>probe:Drosophila_2:1632489_a_at:729:381; Interrogation_Position=464; Antisense; GAACGGGATTTACTTCTGAGCCCTG
>probe:Drosophila_2:1632489_a_at:694:529; Interrogation_Position=516; Antisense; GGGTCAAGGCCCACGATGAACGCAT
>probe:Drosophila_2:1632489_a_at:466:23; Interrogation_Position=642; Antisense; ATAGTCTGGAAACGCCCACCGAGGA
>probe:Drosophila_2:1632489_a_at:89:281; Interrogation_Position=689; Antisense; CTCAACGCGGTGGTGGCTGGTATAA
>probe:Drosophila_2:1632489_a_at:135:589; Interrogation_Position=706; Antisense; TGGTATAATGGGTACCCAGCTCCCT
>probe:Drosophila_2:1632489_a_at:438:289; Interrogation_Position=735; Antisense; CGGGCACCGTGGTTCTAGAGCAGAA
>probe:Drosophila_2:1632489_a_at:717:477; Interrogation_Position=766; Antisense; GTTTCTGAAACCCTGTCGTATTGAG
>probe:Drosophila_2:1632489_a_at:636:689; Interrogation_Position=784; Antisense; TATTGAGACCGACACCGTGGTGACC
>probe:Drosophila_2:1632489_a_at:312:519; Interrogation_Position=800; Antisense; GTGGTGACCGTACGTCTGCTACAAT
>probe:Drosophila_2:1632489_a_at:563:237; Interrogation_Position=822; Antisense; AATCTCGCAAGATTTCCACCGTGGA

Paste this into a BLAST search page for me
TAAAACTGCTAACCGGCCTCTTTGTTGCGCACTGATCACCCGGAAATAGTGAAATAGTACTTCACAGCCTGGCGCAGCCTGGCGCTCTTTTACCAATTACGAACGGGATTTACTTCTGAGCCCTGGGGTCAAGGCCCACGATGAACGCATATAGTCTGGAAACGCCCACCGAGGACTCAACGCGGTGGTGGCTGGTATAATGGTATAATGGGTACCCAGCTCCCTCGGGCACCGTGGTTCTAGAGCAGAAGTTTCTGAAACCCTGTCGTATTGAGTATTGAGACCGACACCGTGGTGACCGTGGTGACCGTACGTCTGCTACAATAATCTCGCAAGATTTCCACCGTGGA

Full Affymetrix probeset data:

Annotations for 1632489_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime