Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632490_at:

>probe:Drosophila_2:1632490_at:676:339; Interrogation_Position=2263; Antisense; GCTATATAGCTGTACTTCTAGAGTA
>probe:Drosophila_2:1632490_at:521:707; Interrogation_Position=2293; Antisense; TTAAAAAGTCGCACATCTCGCCGTT
>probe:Drosophila_2:1632490_at:115:153; Interrogation_Position=2305; Antisense; ACATCTCGCCGTTACATTAGTTGAG
>probe:Drosophila_2:1632490_at:47:483; Interrogation_Position=2329; Antisense; GTATCGGGTATCTAAATCTCTAATT
>probe:Drosophila_2:1632490_at:432:513; Interrogation_Position=2431; Antisense; GTGTTTCCGACCTTATATTGTGTAC
>probe:Drosophila_2:1632490_at:561:513; Interrogation_Position=2450; Antisense; GTGTACTTATACCTAGATCGGGAAC
>probe:Drosophila_2:1632490_at:483:177; Interrogation_Position=2479; Antisense; AAACTTAAGGTTAGGCATCTCGCAC
>probe:Drosophila_2:1632490_at:667:295; Interrogation_Position=2499; Antisense; CGCACGCCCGCTGAAAATGTTTAGA
>probe:Drosophila_2:1632490_at:330:481; Interrogation_Position=2558; Antisense; GTTTGTTTTGCCAATTCCTAGAGAA
>probe:Drosophila_2:1632490_at:14:151; Interrogation_Position=2592; Antisense; ACATTTTGGTCACGTTCACTCTTAA
>probe:Drosophila_2:1632490_at:389:537; Interrogation_Position=2599; Antisense; GGTCACGTTCACTCTTAAATGCATT
>probe:Drosophila_2:1632490_at:278:53; Interrogation_Position=2617; Antisense; ATGCATTTTTGAAATTTCTCCGTCG
>probe:Drosophila_2:1632490_at:723:713; Interrogation_Position=2632; Antisense; TTCTCCGTCGTTTCACTAGTTGAGT
>probe:Drosophila_2:1632490_at:530:193; Interrogation_Position=2668; Antisense; AACTCGATGATAGCGTTCCTCTTAA

Paste this into a BLAST search page for me
GCTATATAGCTGTACTTCTAGAGTATTAAAAAGTCGCACATCTCGCCGTTACATCTCGCCGTTACATTAGTTGAGGTATCGGGTATCTAAATCTCTAATTGTGTTTCCGACCTTATATTGTGTACGTGTACTTATACCTAGATCGGGAACAAACTTAAGGTTAGGCATCTCGCACCGCACGCCCGCTGAAAATGTTTAGAGTTTGTTTTGCCAATTCCTAGAGAAACATTTTGGTCACGTTCACTCTTAAGGTCACGTTCACTCTTAAATGCATTATGCATTTTTGAAATTTCTCCGTCGTTCTCCGTCGTTTCACTAGTTGAGTAACTCGATGATAGCGTTCCTCTTAA

Full Affymetrix probeset data:

Annotations for 1632490_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime