FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632491_at:

>probe:Drosophila_2:1632491_at:130:541; Interrogation_Position=1298; Antisense; GGTTGAGTTCCAACTTCGACCTGTA
>probe:Drosophila_2:1632491_at:472:191; Interrogation_Position=1309; Antisense; AACTTCGACCTGTACAATACCTTGA
>probe:Drosophila_2:1632491_at:21:455; Interrogation_Position=1498; Antisense; GATCAAGGAACTTGGCGCTTGGCCA
>probe:Drosophila_2:1632491_at:30:581; Interrogation_Position=1517; Antisense; TGGCCAATCTGGTTGTTGATCGCAT
>probe:Drosophila_2:1632491_at:582:27; Interrogation_Position=1548; Antisense; ATACCTTCATTACCATAATCTGCAG
>probe:Drosophila_2:1632491_at:617:365; Interrogation_Position=1572; Antisense; GAATCTGTGTAGCAATCTTACCCTG
>probe:Drosophila_2:1632491_at:149:427; Interrogation_Position=1596; Antisense; GAGAGTAATCAACAGCACCGAAGTA
>probe:Drosophila_2:1632491_at:17:225; Interrogation_Position=1633; Antisense; AAGGACGTCGATCTAGCGAATGGAA
>probe:Drosophila_2:1632491_at:90:565; Interrogation_Position=1654; Antisense; GGAATGCGACACTACCATACCAAAT
>probe:Drosophila_2:1632491_at:476:691; Interrogation_Position=1708; Antisense; TTTGCCACCGTTCTGTACGATAAGC
>probe:Drosophila_2:1632491_at:721:349; Interrogation_Position=1731; Antisense; GCAGACAGAAGAGCTCCAAATGAAT
>probe:Drosophila_2:1632491_at:325:595; Interrogation_Position=1755; Antisense; TGTGGAGCTCATCAGTCGAACTAAT
>probe:Drosophila_2:1632491_at:483:217; Interrogation_Position=1822; Antisense; AAGTTATATTGCGTTTGCTTGTCAA
>probe:Drosophila_2:1632491_at:212:481; Interrogation_Position=1834; Antisense; GTTTGCTTGTCAAAGCTGCGAGCTA

Paste this into a BLAST search page for me
GGTTGAGTTCCAACTTCGACCTGTAAACTTCGACCTGTACAATACCTTGAGATCAAGGAACTTGGCGCTTGGCCATGGCCAATCTGGTTGTTGATCGCATATACCTTCATTACCATAATCTGCAGGAATCTGTGTAGCAATCTTACCCTGGAGAGTAATCAACAGCACCGAAGTAAAGGACGTCGATCTAGCGAATGGAAGGAATGCGACACTACCATACCAAATTTTGCCACCGTTCTGTACGATAAGCGCAGACAGAAGAGCTCCAAATGAATTGTGGAGCTCATCAGTCGAACTAATAAGTTATATTGCGTTTGCTTGTCAAGTTTGCTTGTCAAAGCTGCGAGCTA

Full Affymetrix probeset data:

Annotations for 1632491_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720